ID: 1007464802

View in Genome Browser
Species Human (GRCh38)
Location 6:42044218-42044240
Sequence ACCTTTTACGGGGGCTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007464794_1007464802 17 Left 1007464794 6:42044178-42044200 CCTGCACGTTCTGGCCGGAGCCT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1007464802 6:42044218-42044240 ACCTTTTACGGGGGCTTTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1007464796_1007464802 3 Left 1007464796 6:42044192-42044214 CCGGAGCCTGGACAAGACAGAAG 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1007464802 6:42044218-42044240 ACCTTTTACGGGGGCTTTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1007464797_1007464802 -3 Left 1007464797 6:42044198-42044220 CCTGGACAAGACAGAAGAGCACC 0: 1
1: 0
2: 0
3: 37
4: 189
Right 1007464802 6:42044218-42044240 ACCTTTTACGGGGGCTTTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007464802 Original CRISPR ACCTTTTACGGGGGCTTTGC TGG Intronic
901798895 1:11695919-11695941 AACCTGTACAGGGGCTTTGCGGG - Intronic
907626143 1:56031879-56031901 TCCTTTTAAGTTGGCTTTGCTGG - Intergenic
911690828 1:100832365-100832387 ATCTTTTAGGGGTTCTTTGCTGG - Intergenic
913146234 1:115993024-115993046 TACTTTCAAGGGGGCTTTGCTGG + Intronic
1063477883 10:6344463-6344485 GCCTTTTACAAGGGCTTTTCGGG + Intergenic
1067165282 10:43861868-43861890 TCCTTTTGCAGGTGCTTTGCTGG + Intergenic
1067178474 10:43967116-43967138 ACCATTCACGGGGTCTTTGTGGG - Intergenic
1070905069 10:80065034-80065056 TCCTTTTAAGTTGGCTTTGCTGG + Intergenic
1074094981 10:110304331-110304353 AACTCTTAGGGGGCCTTTGCAGG - Intronic
1077586002 11:3453759-3453781 ATCTTTTGCGGGGGCTCTCCAGG + Intergenic
1084441968 11:69179674-69179696 ACCTTTCAGGGGTGCTTTGGAGG - Intergenic
1085551858 11:77381047-77381069 ACCTTTTATCAGGGTTTTGCTGG - Intronic
1095323309 12:40857077-40857099 ACTTTTTAAGGGGGTTTTGTAGG + Intronic
1096408191 12:51358852-51358874 GCCTCTTACGGAGGCTTTGGAGG - Intronic
1105990843 13:25619144-25619166 ACCTTTTGTGGAGGCTTTTCAGG + Intronic
1107845060 13:44504108-44504130 ACATTTTACAGGGGCTTTGATGG - Intronic
1108464559 13:50701872-50701894 CCCTTTAACGAGGTCTTTGCAGG - Intronic
1113132404 13:107052585-107052607 TCCTTTTAAGTTGGCTTTGCTGG - Intergenic
1115867334 14:37761391-37761413 ACCTTTTGCGTGGGTCTTGCTGG + Intronic
1120512962 14:85438069-85438091 ACCTTTTATGGAGACTTCGCTGG - Intergenic
1130678599 15:85976387-85976409 ACCTTTCACAAGGGCTTTGCAGG + Intergenic
1131812216 15:96184451-96184473 TACTTTTACAGAGGCTTTGCAGG - Intergenic
1132635817 16:945900-945922 ACCTTGTACTGAGGCTTTTCTGG - Intronic
1154071229 18:11153499-11153521 ACATTTTACGTAGGCTTAGCAGG - Intergenic
1155825195 18:30433114-30433136 ACCTTTAGTGGGAGCTTTGCAGG + Intergenic
1157777171 18:50404751-50404773 ACCCTTTACGGGTGTTGTGCTGG + Intergenic
1166659093 19:44634062-44634084 ACCTTTTACGGGGGTTCCCCAGG + Intronic
926455706 2:13066282-13066304 ACATTTTAAGGGCTCTTTGCTGG + Intergenic
929026581 2:37610165-37610187 ACCTAATACAGGGGCTTTGGGGG + Intergenic
931890228 2:66663137-66663159 GCATTTTAAAGGGGCTTTGCAGG + Intergenic
932286620 2:70539308-70539330 CCATTTTACGGGGGTTTTGATGG - Intronic
934474714 2:94586593-94586615 CTCCTTTATGGGGGCTTTGCTGG + Intergenic
935444322 2:103140106-103140128 ACCTATTACGGGGACTCTGCAGG - Intergenic
936970399 2:118171272-118171294 CCCTGTTAGAGGGGCTTTGCTGG + Intergenic
942978069 2:182043312-182043334 ACCTTTTGAGGAGGCTTGGCAGG - Intronic
947098225 2:226591238-226591260 ACCTTTGAAGGGGGTTTTGTGGG + Intergenic
947482580 2:230514693-230514715 TCCTTTTAAGTTGGCTTTGCTGG + Intronic
1181535542 22:23541055-23541077 ATCTTTTGTGGGGGCTTTCCAGG - Intergenic
949183973 3:1168304-1168326 ACCATTTACTGGGGCTTTTGGGG - Intronic
953786909 3:45917787-45917809 ATCTTTTATGGTGGCTTTTCAGG - Intergenic
962813345 3:138977440-138977462 ACATTTGCCGGGGACTTTGCAGG - Intergenic
967007820 3:185401038-185401060 ACCTTGTTTGGGGGCTCTGCAGG + Intronic
969812727 4:9661159-9661181 ATCTTTTGCGGGGGCTCTCCAGG - Intergenic
976540786 4:86272764-86272786 ACCTTTTCCAGGAGATTTGCTGG + Intronic
982537507 4:156625322-156625344 AGCTTTTAGGGGGGATTTGATGG - Intergenic
986314761 5:6579221-6579243 ACCTCCTGCCGGGGCTTTGCAGG + Intergenic
987116998 5:14733673-14733695 ATCATTTACATGGGCTTTGCTGG + Intronic
999752692 5:154641384-154641406 ATCTTTTGCGGGGGCTATCCAGG + Intergenic
1003116022 6:3284433-3284455 GCCATTTACGAGGGCTTTGATGG - Intronic
1004361464 6:14974943-14974965 ACCTCTTACAGGGGCTGTGTTGG - Intergenic
1004533914 6:16480950-16480972 ACCTTTGGCAGGGTCTTTGCAGG - Intronic
1004539170 6:16533257-16533279 ACCTTATAAGGGAGCTTTTCAGG + Intronic
1007464802 6:42044218-42044240 ACCTTTTACGGGGGCTTTGCTGG + Intronic
1007572068 6:42900018-42900040 ATCTTTTGCGGGGGCTCTCCAGG + Intergenic
1020479630 7:8642167-8642189 CCTTTTTACGGGTACTTTGCAGG + Intronic
1034957560 7:155344475-155344497 TCCCTTTTCTGGGGCTTTGCCGG + Intergenic
1038199541 8:25399249-25399271 ACCTGTTACAGGGACTTAGCTGG + Intronic
1040665218 8:49623611-49623633 ACATTTTAAGTGTGCTTTGCTGG - Intergenic
1042933287 8:74033957-74033979 TCCTTTTAAGTTGGCTTTGCTGG - Intergenic
1052855337 9:33403165-33403187 GTCCTTTACGGGGGCCTTGCTGG - Intergenic
1053683348 9:40499508-40499530 CTCCTTTACGGGGGCCTTGCTGG - Intergenic
1053933328 9:43127823-43127845 CTCCTTTACGGGGGCCTTGCTGG - Intergenic
1054280366 9:63125420-63125442 CTCCTTTACGGGGGCCTTGCTGG + Intergenic
1054296452 9:63335006-63335028 CTCCTTTACGGGGGCCTTGCTGG - Intergenic
1054394469 9:64639511-64639533 CTCCTTTACGGGGGCCTTGCTGG - Intergenic
1054429118 9:65144710-65144732 CTCCTTTACGGGGGCCTTGCTGG - Intergenic
1054501265 9:65876825-65876847 CTCCTTTACGGGGGCCTTGCTGG + Intergenic
1056109429 9:83380170-83380192 ATCTTTCACAGGGGCTTTGCAGG - Intronic
1056548357 9:87631409-87631431 AACTTTTAGGGAGGCTTTGGTGG + Intronic
1190455966 X:50628105-50628127 ACCCTTGAGGGGGGCTTTGAGGG + Intronic
1190570464 X:51776536-51776558 TCCTTTTAAGTTGGCTTTGCTGG - Intergenic
1191068546 X:56376478-56376500 TCCTTTTACGTTGGCTTTGCTGG + Intergenic
1193170365 X:78329040-78329062 ACCCTTTACGGGTGTTGTGCTGG - Intergenic
1193703942 X:84797151-84797173 ACGTTTTAATGGGGTTTTGCTGG + Intergenic
1195922569 X:109998260-109998282 AAATTTTACGTGGGCTTTGAAGG + Intergenic
1196301597 X:114054805-114054827 TCCTTTTAAGTTGGCTTTGCTGG - Intergenic
1201318345 Y:12670232-12670254 TCCTTTTAAGTTGGCTTTGCTGG + Intergenic