ID: 1007465141

View in Genome Browser
Species Human (GRCh38)
Location 6:42046394-42046416
Sequence TGGTAGATGAGTAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007465141 Original CRISPR TGGTAGATGAGTAAGGAAGA TGG (reversed) Intronic
901430724 1:9212856-9212878 TGGTAGAAGAGAAAGGTAGGAGG - Intergenic
902079166 1:13809364-13809386 TGGTAGAAGAGGAAGGAAGGCGG + Intronic
902155075 1:14478579-14478601 TGAAGGAAGAGTAAGGAAGAAGG - Intergenic
905101201 1:35523595-35523617 TGGTAGATGAGTAATGATTACGG + Intronic
905970189 1:42135979-42136001 TTGTAGAACAGAAAGGAAGAAGG - Intergenic
906109040 1:43311437-43311459 TGGTAGATGAGGAAGTGACATGG - Intronic
906470893 1:46130130-46130152 TGGGAGGTGAGTAGGGAGGAGGG - Intronic
906885865 1:49647781-49647803 TCGTAGGTGGGTCAGGAAGAAGG - Intronic
907029432 1:51156144-51156166 TGGCAGATTAGTATGCAAGATGG + Intergenic
907253379 1:53158971-53158993 TGGGAGTTGAGGCAGGAAGATGG + Intergenic
907924871 1:58946018-58946040 TGCTAGATGAGGGAGGAAGGAGG - Intergenic
909583921 1:77267946-77267968 TCATAGATGAGTGGGGAAGAGGG + Intergenic
909584676 1:77276458-77276480 AGGTACATAAATAAGGAAGAAGG + Intergenic
909733641 1:78929174-78929196 TTTTAGAAGAGTAAGGAGGAAGG - Intronic
910852200 1:91659527-91659549 TGGGAAATGGATAAGGAAGAAGG - Intergenic
913184216 1:116353614-116353636 TAGGAGATGACTAAGAAAGAAGG - Intergenic
913518460 1:119624092-119624114 GGGCAGCTGAGTGAGGAAGAAGG - Exonic
914915012 1:151814317-151814339 TGGTAGAGGAGGTAGGATGAAGG + Intronic
915248298 1:154571126-154571148 GGGTTGATGGGTAAGGAGGAAGG + Intronic
915367939 1:155325774-155325796 TGGGAGATGAGATTGGAAGAGGG - Intronic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
916276423 1:162998979-162999001 AGGTAGATGAGAAGGGAAGAAGG + Intergenic
916864790 1:168844832-168844854 GGGAAGATTAGTAAGGGAGAAGG - Intergenic
918989083 1:191674661-191674683 TGGTGGGTGAGTAGGGATGAGGG - Intergenic
919171079 1:193954911-193954933 TGGGAGATAAGAAAGGAAGTGGG + Intergenic
919968897 1:202558348-202558370 AAGTAGAAGAGTAAGGGAGAGGG - Intronic
920199412 1:204250326-204250348 TGGTAGATCAGAAAAGAAGGGGG + Intronic
920612713 1:207457092-207457114 AGGTACATAAATAAGGAAGAAGG - Intronic
920727552 1:208450348-208450370 AGGCAGATGAGAAAGGGAGAGGG + Intergenic
921487228 1:215729540-215729562 AGGTAGCTGAGTAGAGAAGATGG + Intronic
921931101 1:220754951-220754973 TGGCTGGTGATTAAGGAAGATGG + Exonic
922052838 1:222010659-222010681 TGGGAGATGAGAAGGGAAGGAGG - Intergenic
922061250 1:222094543-222094565 GGGTAGATATGTAAGGAAAATGG - Intergenic
922871446 1:228905186-228905208 AAGTAGATGAGGAAGGCAGAAGG + Intergenic
923845338 1:237724421-237724443 GGGTATTTGAGTAAGCAAGAAGG - Intronic
1062981456 10:1726293-1726315 TGACAGATCAGTAAGGTAGATGG + Intronic
1063909503 10:10814959-10814981 TGGTAATTTATTAAGGAAGAGGG - Intergenic
1064151709 10:12871125-12871147 TGGAAAATGAGGAAGGAAGAAGG + Intergenic
1064342039 10:14496015-14496037 TGGTAGATGAGTTAGGTAGGTGG - Intergenic
1065633481 10:27706957-27706979 TGGTAGATGAGCATAGAACAAGG - Intronic
1067540556 10:47148431-47148453 TGGAACATAAGAAAGGAAGAAGG + Intergenic
1067669302 10:48305106-48305128 TGCTGGAGGAGCAAGGAAGAAGG - Intergenic
1068301427 10:55146427-55146449 TGGTAGAGGCAAAAGGAAGATGG + Intronic
1068326765 10:55500166-55500188 TGGTAAATGACTAAGGAAACAGG + Intronic
1068412214 10:56670978-56671000 TGGCTGGTGAGTAAAGAAGAAGG - Intergenic
1069609491 10:69763280-69763302 TGGTAGTTGAGTGGGGAAGTGGG + Intergenic
1070068129 10:73058275-73058297 TGGTAGATTAGCATGCAAGATGG - Intronic
1072019629 10:91385296-91385318 GAGTGGGTGAGTAAGGAAGAGGG - Intergenic
1072733217 10:97862009-97862031 TGCTGCATGAGTGAGGAAGAAGG + Intronic
1072850609 10:98887474-98887496 TAGTAAATGAGGAAGCAAGAAGG + Intronic
1073023079 10:100463107-100463129 TGGGAGATGGGTAAGCAAGACGG - Exonic
1074228789 10:111513401-111513423 TGTCAGCTGAGTAGGGAAGAGGG + Intergenic
1074325049 10:112442335-112442357 TGTTAGATGTGTGATGAAGATGG - Exonic
1074390417 10:113053011-113053033 TAGCAGATGAATCAGGAAGAAGG - Intronic
1074720254 10:116257784-116257806 TCGAAGATGGGAAAGGAAGATGG - Intronic
1075396367 10:122130582-122130604 AGGTGGAAGAGGAAGGAAGAGGG - Intronic
1075662983 10:124210968-124210990 TGGTAGATGAGGAAGCAGGATGG + Intergenic
1075861705 10:125682926-125682948 TGGGAGATGGGTAAGGAAGATGG - Exonic
1077640916 11:3880791-3880813 TGGTTGAGGAGTAAGGGAAAGGG - Intronic
1078443035 11:11383267-11383289 GGGTAGATGAGGAAGGGAGAAGG - Intronic
1081246927 11:40778624-40778646 CGGTAGAGGAGGAAGGAAAAAGG + Intronic
1081697034 11:45119861-45119883 TAGGAGATGAGCAAGGAAGGGGG + Intronic
1084906519 11:72352510-72352532 AGGTAGATGAGGTAGGAAGGCGG - Intronic
1085140443 11:74135962-74135984 TACTAGAGGGGTAAGGAAGATGG + Intronic
1085428948 11:76430051-76430073 TCGTAGTTGAGTGGGGAAGATGG - Intergenic
1087940099 11:104086233-104086255 TGGGAGATGAGAAGGAAAGAGGG + Intronic
1088259687 11:107932411-107932433 TGGCAGAAAATTAAGGAAGAAGG - Intronic
1088391932 11:109323956-109323978 TGCCAGAGAAGTAAGGAAGAGGG - Intergenic
1088483571 11:110319788-110319810 TGGGAGAAGAGTGAGGAAGTAGG - Intergenic
1088587568 11:111373000-111373022 TGGCAGATTAGAAAGGAAAAAGG + Intronic
1088837025 11:113586484-113586506 TGGTAGATTGGAAAGCAAGATGG - Intergenic
1088838303 11:113598615-113598637 TGAAAGATGAGAAAGGAAAAAGG + Intergenic
1089143248 11:116305092-116305114 TGGAAGATGAGTAGGGAATTTGG + Intergenic
1089457435 11:118633787-118633809 GGGTAGATGAGTTGGGTAGAGGG + Intronic
1089624795 11:119744490-119744512 TGGTAGATGGGTAATAAATAGGG + Intergenic
1090368784 11:126230994-126231016 TGGTGGATGAAAAAGGAAAAAGG - Intronic
1090821676 11:130348056-130348078 TGCTGGAAGAGTGAGGAAGATGG - Intergenic
1091329854 11:134723829-134723851 GGGGAGATGTCTAAGGAAGATGG - Intergenic
1092438350 12:8472909-8472931 TAGTAGAGGAGGAAGGGAGAGGG - Intronic
1092677489 12:10937743-10937765 TGGTAGTTTAGTAAGGCAGCTGG + Exonic
1093084727 12:14854127-14854149 TGGCAGCTGAGGAGGGAAGATGG - Intronic
1093152011 12:15632995-15633017 TGGTAGATGCTGAGGGAAGAAGG + Intronic
1094334385 12:29332022-29332044 TGGGGGAGGAGTAGGGAAGAAGG - Intronic
1094794288 12:33952478-33952500 TTGAAAATGAGTAAGGAAGATGG - Intergenic
1095106134 12:38235093-38235115 TCGAAAATGAGTAAGGAAGATGG - Intergenic
1095307295 12:40653093-40653115 TGGTAGAAGAGAAAGGGAAAGGG - Intergenic
1095334683 12:41010940-41010962 TGGTAGATTAAAAAGGAAAAAGG - Intronic
1095547621 12:43389853-43389875 GGGCACATGAGCAAGGAAGAGGG - Intronic
1096069330 12:48766315-48766337 TGGTAGAGGAGTCAGGAGGTGGG - Exonic
1096610639 12:52798978-52799000 TGGTGGAAGAAAAAGGAAGAAGG + Intergenic
1096838596 12:54367698-54367720 TGGATGAAGAGTTAGGAAGAAGG + Intergenic
1098409302 12:70163236-70163258 GGGTGGATGAATAAGAAAGAAGG + Intergenic
1098418031 12:70258944-70258966 TGGTAGATGGGTACAGAAAAGGG + Intronic
1099744602 12:86686374-86686396 TTGAATAGGAGTAAGGAAGAGGG + Intronic
1100254326 12:92867031-92867053 TGGAAGATTAATTAGGAAGAGGG - Intronic
1100325931 12:93539989-93540011 TGGCAGATGGGTCAGGAACAGGG - Intergenic
1100813630 12:98364353-98364375 TGGTGGAGGAGCAAGGAAGGTGG - Intergenic
1101735310 12:107458856-107458878 TGGCAGATGAATAAAGGAGAAGG - Intronic
1102075998 12:110060650-110060672 AAGTAGATGAGAAAGCAAGAGGG - Intronic
1102800563 12:115729426-115729448 TAAAGGATGAGTAAGGAAGAAGG + Intergenic
1104398729 12:128458419-128458441 TGGTATGTGAGCAAGAAAGAAGG - Intronic
1104472094 12:129037371-129037393 TGTTGAATGAGTAAGCAAGATGG + Intergenic
1105864613 13:24448103-24448125 TGGGGGATGAGGGAGGAAGATGG + Intronic
1106239372 13:27898040-27898062 TGGAATATTAGGAAGGAAGAAGG - Intergenic
1107892238 13:44924426-44924448 GGATAGATGAGGAGGGAAGAAGG - Intergenic
1108070619 13:46625218-46625240 TAATAGAAGAGTATGGAAGAGGG - Intronic
1108146376 13:47481595-47481617 TTGAAGATGTGTAAGCAAGAGGG + Intergenic
1108614791 13:52121628-52121650 GGCTAGATGAGAAAGAAAGAGGG - Intronic
1108962833 13:56257787-56257809 TTGTGGGTGAGTAAAGAAGATGG + Intergenic
1109278596 13:60329994-60330016 GGAGAGATGAGCAAGGAAGAAGG + Intergenic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1109925326 13:69129556-69129578 AGCTAGAATAGTAAGGAAGATGG - Intergenic
1110214255 13:73009041-73009063 TGGTTGAAGAGAAAGGAAGAGGG - Intronic
1110420731 13:75304787-75304809 ATGTAGAGAAGTAAGGAAGAAGG + Intronic
1112171618 13:96978148-96978170 AGCTAGATGAGTTAGTAAGATGG - Intergenic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1115941432 14:38614916-38614938 TGATAGGTGATTAAAGAAGATGG + Intergenic
1116495432 14:45554272-45554294 TGCTAAATGAGTAGGGAATAAGG + Intergenic
1116711846 14:48378214-48378236 TGGTAGTGAAGTAGGGAAGAGGG + Intergenic
1116927960 14:50660354-50660376 AGGCAGCTGAGTAAGGAGGATGG - Intronic
1118462460 14:65999405-65999427 TGGTGGATGCCTAAGAAAGAGGG - Intronic
1119143611 14:72290440-72290462 AGGAAGCTGAGGAAGGAAGAGGG - Intronic
1119604437 14:76002445-76002467 TGTTAGATGAGGAGGGAAGGAGG + Intronic
1119681056 14:76592502-76592524 TGGTAGAACAGAAAGGCAGAAGG + Intergenic
1120120132 14:80668940-80668962 TGGTAGAACAGGAAGGATGAAGG - Intronic
1122234445 14:100323811-100323833 GGGGAGATGGGTAGGGAAGATGG + Intronic
1122731500 14:103802493-103802515 GGGTAGAAGGGTAAGGAACAAGG - Intronic
1124808306 15:32908176-32908198 GGGTAACTGAGGAAGGAAGAAGG - Intronic
1125098728 15:35885320-35885342 TGAGAGATGGGTAAGGAAGAGGG - Intergenic
1125241397 15:37581516-37581538 GGCCAGATGAGTAAGGCAGAGGG - Intergenic
1125762299 15:42104933-42104955 CAGTAGCTGAGTGAGGAAGAGGG - Intergenic
1126783105 15:52155184-52155206 AGGTAGGTGAGGAGGGAAGAGGG + Intronic
1126905088 15:53356416-53356438 TGGGAAAGGAGTAAGAAAGAGGG - Intergenic
1127131568 15:55870023-55870045 AGGCATATGAGTAAAGAAGAGGG + Intronic
1127218970 15:56857408-56857430 GGCAAGATGATTAAGGAAGATGG - Intronic
1127804417 15:62505749-62505771 TGGTACATGAGGAAGGTGGAAGG + Intronic
1127864107 15:63017729-63017751 TGGCAGAAGAACAAGGAAGATGG - Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129687008 15:77692117-77692139 CGTAAGATGAGTAAGTAAGAAGG - Intronic
1129939592 15:79482676-79482698 TGATAGATGTGTAAAGAAGCAGG + Intergenic
1130380959 15:83372036-83372058 TGGTAGTTGAATGGGGAAGAAGG + Intergenic
1132215502 15:100058777-100058799 TGGGAGAGGTGTCAGGAAGAGGG + Intronic
1132888419 16:2192770-2192792 TGGTAGTTGAGTGATGGAGATGG - Intronic
1133390496 16:5406258-5406280 TGGTGGATGAGTACAGCAGATGG + Intergenic
1133408536 16:5548221-5548243 TGGTGGGGGAGAAAGGAAGAAGG + Intergenic
1133636458 16:7670495-7670517 TGAAAGATGGGAAAGGAAGAGGG + Intronic
1133874941 16:9725077-9725099 TGGTAGTTGGGGAAGAAAGAAGG - Intergenic
1134800166 16:17076945-17076967 AAGGAGATGAGTAAGGAAAATGG - Intergenic
1135674568 16:24404466-24404488 TGGTAGAAGAGTCAGCAGGACGG + Intergenic
1136599706 16:31276878-31276900 GGGTTGATGAGGAAGGAAGAAGG - Intronic
1136683193 16:31979586-31979608 TGGTAAATGAGTGAGGGAGTTGG - Intergenic
1136783826 16:32923142-32923164 TGGTAAATGAGTGAGGGAGTTGG - Intergenic
1136885958 16:33930664-33930686 TGGTAAATGAGTGAGGGAGTTGG + Intergenic
1137044195 16:35641143-35641165 TGGTAGCTGAGTGTGGAAAAAGG + Intergenic
1138134936 16:54513276-54513298 TGGTAGGTGGGGAAGGCAGATGG - Intergenic
1139486963 16:67263253-67263275 AGGTAGATGAGGAGGGCAGATGG + Intronic
1203086483 16_KI270728v1_random:1187144-1187166 TGGTAAATGAGTGAGGGAGTTGG - Intergenic
1143873640 17:9975557-9975579 TGATAGATGAGGAAGGAGAACGG - Intronic
1144241260 17:13314870-13314892 AGGAAGATGAGTGAGGAAAAAGG + Intergenic
1144935870 17:18898382-18898404 TGGAATATCAGCAAGGAAGAAGG - Intronic
1146395522 17:32462145-32462167 TGGTAGATGAGTGTGGTAAATGG + Intronic
1147444212 17:40464900-40464922 TGGTAGAAAAGTAAGGTTGAGGG - Intergenic
1147569917 17:41563375-41563397 TGGTAGATGAGGAAGACAGCAGG + Intergenic
1150963980 17:69946891-69946913 AGGTAGAGGAATATGGAAGATGG - Intergenic
1150965552 17:69963937-69963959 TTGTTAAAGAGTAAGGAAGATGG - Intergenic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1151383734 17:73742787-73742809 TGGGAGAAGAGCAAGGAACACGG + Intergenic
1153066235 18:1048166-1048188 TGGAGGCTGAGTAAGGAAGAAGG + Intergenic
1153569999 18:6461150-6461172 TCGTGGATGAGCAAAGAAGATGG + Intergenic
1153976578 18:10273363-10273385 TGGAAGATGAGGAAGAGAGAAGG + Intergenic
1154018895 18:10645215-10645237 GGGGAGGTGAGGAAGGAAGAGGG - Intergenic
1154061437 18:11064387-11064409 TGGTAAAAGAGGAGGGAAGAAGG - Intronic
1156008680 18:32471387-32471409 TGGTAGAGGAGTAGGGTTGAGGG - Intergenic
1157476004 18:48024075-48024097 GGGTAGTTGTGTTAGGAAGAAGG + Intergenic
1161604936 19:5209531-5209553 TGGTACAAGATTGAGGAAGATGG - Intronic
1162857373 19:13479250-13479272 AGACAGATGAGTAAGTAAGAAGG + Intronic
1162923528 19:13918363-13918385 TGGAAGAGGATTAAGCAAGATGG + Intronic
1163452268 19:17385458-17385480 TGGCAGATGTGTAAGTAGGAGGG - Intergenic
1164254708 19:23517368-23517390 GACTAGATGGGTAAGGAAGAGGG + Intergenic
1165716963 19:38052622-38052644 TGATAGATGAGAAAGCCAGAGGG + Intronic
1166035498 19:40165267-40165289 TGCTATGGGAGTAAGGAAGAGGG - Intergenic
1166485135 19:43205994-43206016 AGCCAGATGAGGAAGGAAGAGGG - Intronic
1167012408 19:46817358-46817380 TTGTCGTTGAGTAAGCAAGAGGG + Intergenic
1168015041 19:53566160-53566182 TGGGAGAGGACTGAGGAAGAGGG - Intronic
926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG + Intergenic
928305582 2:30167769-30167791 TGGTGGACTAGGAAGGAAGATGG - Intergenic
928549862 2:32359438-32359460 TGGTAGATTACTAAAGAGGAGGG + Intronic
928663970 2:33531899-33531921 TGGAAGCTGAGTCAGGAGGAAGG + Intronic
929605262 2:43229707-43229729 TGCTGGATGTGTGAGGAAGAGGG + Intergenic
932009377 2:67960055-67960077 TGGCATATGAGTTTGGAAGAAGG - Intergenic
932541889 2:72664066-72664088 TGGGAGACGAGGCAGGAAGATGG + Intronic
933134459 2:78714954-78714976 TGGGAAATGAGTAGAGAAGAAGG - Intergenic
934331895 2:92075734-92075756 GGGAAGAGGAGAAAGGAAGATGG + Intergenic
934968613 2:98744709-98744731 AGGTAGAGGAGACAGGAAGAAGG + Intergenic
935877636 2:107528705-107528727 TGGGGGCTGCGTAAGGAAGAAGG + Intergenic
936442712 2:112568893-112568915 TGCCAGATGGGTAAGGAAGAGGG + Exonic
936501668 2:113071776-113071798 TGAGAGAAGAGAAAGGAAGAAGG - Intronic
938044734 2:128108029-128108051 TTGTAGCTGAGTAAGAACGAAGG - Exonic
938127122 2:128682638-128682660 TGGTAGATGAGCAGGGATGAGGG + Intergenic
939397926 2:141655308-141655330 TGGTAGAATAATAAGGAAGGAGG + Intronic
939442030 2:142261784-142261806 TTGTTGATGTGTAAGGAAGAAGG + Intergenic
940270639 2:151886251-151886273 TGGTACGTAAGTCAGGAAGAAGG + Intronic
942115398 2:172724352-172724374 TGGCAGATGAGTGAGGAAAAAGG - Intergenic
943084237 2:183293646-183293668 TGGTAGAAGAGGAAGAAAGAGGG + Intergenic
943151731 2:184122442-184122464 TGGTAAGTGACTAAGGAAGTAGG - Intergenic
943321938 2:186455369-186455391 TGGAAGGTGAATAAAGAAGAGGG - Intergenic
943562677 2:189482723-189482745 AGTTAGATGAGTCAGGAAGAAGG - Intergenic
944319590 2:198322815-198322837 TGATAGAGGAGTGGGGAAGATGG - Intronic
944533690 2:200689153-200689175 TGGTAGATGGGGAAGAGAGAAGG + Intergenic
944777148 2:202978338-202978360 TGGGAGATGAGGAAGGAGTAGGG + Intronic
945601407 2:211870070-211870092 TGGTAGACAATAAAGGAAGAAGG - Intronic
946067567 2:217001842-217001864 TGATAGATGAGCAAGGCAGTAGG - Intergenic
947402733 2:229744505-229744527 TGGCTGATGAGAAAGGAAAATGG - Intergenic
947537740 2:230951510-230951532 TGGCAGATGTCTAGGGAAGAGGG + Intronic
948164152 2:235848366-235848388 AGGTAAATGAATAAGGAACAAGG + Intronic
948204761 2:236157628-236157650 TGGTGGATTAGTTAGAAAGATGG - Intergenic
949064590 2:241982065-241982087 TGGTAGATGGGTAGGTCAGATGG + Intergenic
1168815263 20:732441-732463 TGATAGATGAGGAAGGGGGAAGG - Intergenic
1169834837 20:9866512-9866534 TGGAAAATGAGTAGAGAAGAGGG + Intergenic
1170922256 20:20690329-20690351 TGGTAGCTAGGTAAGGAGGAGGG - Intronic
1172043641 20:32063644-32063666 TGGTAGAAGAGAAGGTAAGATGG - Intronic
1173242835 20:41312998-41313020 GGGTAGGTGAATTAGGAAGATGG + Intronic
1173468724 20:43305676-43305698 TTGGAGAAGAGTAAGGAAGAGGG + Intergenic
1175393305 20:58641072-58641094 AGGCAGATGGGCAAGGAAGAGGG - Intergenic
1175657819 20:60787077-60787099 GGGTAGAGGAGGAGGGAAGAGGG - Intergenic
1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG + Intergenic
1176983390 21:15408601-15408623 TTGTTGGAGAGTAAGGAAGATGG + Intergenic
1177236456 21:18396039-18396061 CGGTAAAGGAGTATGGAAGATGG + Intronic
1179032402 21:37732023-37732045 TCTTAGATGAGGAAGGGAGATGG + Intronic
1179863621 21:44204368-44204390 TGGCAGATGAATGAGGAGGAGGG - Intergenic
1181409461 22:22708695-22708717 TGTTAGATAAGCAAGGGAGATGG - Intergenic
1182299955 22:29331741-29331763 TGGTAGGTGAGTAAGGACTGGGG + Intronic
1182877243 22:33702827-33702849 TATTAGATAAGCAAGGAAGAGGG + Intronic
1184829471 22:46975052-46975074 TGGTAGGTGAGTCAGGAATGAGG + Intronic
949634474 3:5967677-5967699 TGGCAGATGAGGAAGGAAGGAGG - Intergenic
950488213 3:13285298-13285320 AGGCAGATGAGTGAGGCAGAGGG - Intergenic
951251382 3:20397908-20397930 TGCTAGAGGTGTAAGGAAGGAGG - Intergenic
953148783 3:40305136-40305158 TGGGAAAAGAGTAAGGAAGGTGG - Intergenic
953284814 3:41596406-41596428 TGGCAGATGAGTAAGATACAGGG + Intronic
953754715 3:45636280-45636302 TGGGGGATGCGTAAGGAACATGG + Intronic
954876415 3:53805771-53805793 GGGAAGATGAGGGAGGAAGAGGG - Intronic
956938866 3:74134483-74134505 TGGCAGCTGTGTCAGGAAGAGGG - Intergenic
957142088 3:76373325-76373347 TAGTAATTGAGAAAGGAAGAGGG + Intronic
960162046 3:114360961-114360983 TGGTAAATAAGTAAAGTAGAAGG + Intronic
962069874 3:132022189-132022211 GGGTAGGTAAGTAAGGAACAAGG + Intronic
962528339 3:136255613-136255635 TGGAAGATGAATAAGGAAATAGG - Intronic
962658078 3:137569802-137569824 TGGTAGAAGAGAGAGGAGGAAGG - Intergenic
963723991 3:148898603-148898625 TGATAGATGAGAAATGAAAAGGG - Intergenic
964507074 3:157411184-157411206 TGGTAGAGCAATAAGGTAGAAGG + Intronic
964661735 3:159127225-159127247 TGACAAATGAGAAAGGAAGAAGG - Intronic
965857726 3:173109117-173109139 TGGTAGTAGAGTATGGAAGAGGG - Intronic
965915840 3:173844298-173844320 TGGTAGTAGAGTAAGACAGAGGG + Intronic
966339239 3:178906565-178906587 TGGTTTTTCAGTAAGGAAGACGG + Intergenic
966668497 3:182500216-182500238 AGGTAGAGGAGTGAGGAACAGGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967516762 3:190378734-190378756 ATGTAGATGAGTCAGGGAGATGG - Intronic
967534657 3:190588429-190588451 TGGAAAATGAATAATGAAGATGG - Intronic
967708221 3:192677185-192677207 TGGAAGGTGAGGAAGGAGGAAGG - Intronic
967824190 3:193865686-193865708 TGTTAGATGAGTCTGTAAGACGG - Intergenic
968630415 4:1647967-1647989 TGGGAGGTGAGGCAGGAAGATGG + Intronic
969539573 4:7778615-7778637 TGGCTGATGAGGAAGGATGACGG + Intronic
970090841 4:12406128-12406150 TGTAAGATGAGTAATGAGGAGGG + Intergenic
970137826 4:12945433-12945455 GGGTGGATGGGTAAGGGAGAAGG - Intergenic
970267775 4:14308047-14308069 TGGTAAATGAGAAAGGAAGAAGG - Intergenic
970751805 4:19372523-19372545 AGGGAGAGGAGTAAGTAAGAAGG + Intergenic
970804844 4:20018622-20018644 GGGAAGATGAGGAAGGAAGTAGG + Intergenic
970871874 4:20825713-20825735 TGGGAGATGAGTCATGAACATGG + Intronic
973938442 4:55876951-55876973 TGGTAACTGAGAAAGAAAGATGG - Intronic
974286524 4:59876088-59876110 GGGTAGATGATAAAGGATGATGG + Intergenic
974372236 4:61032489-61032511 TGGTACATGAGTAAAGCAAATGG + Intergenic
974570306 4:63637771-63637793 TGATTTAGGAGTAAGGAAGAAGG - Intergenic
975805143 4:78104384-78104406 TGGCAGATGGGTGGGGAAGAGGG + Intronic
977022942 4:91777999-91778021 TGATAGATAAGTAAGCAACAAGG - Intergenic
977372378 4:96155397-96155419 TGGCAAAAGAGTAATGAAGATGG - Intergenic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
977922190 4:102658033-102658055 TGGTTGTTGAATAGGGAAGAAGG - Intronic
978125700 4:105132733-105132755 TTGTAGATGAGCAAAGAAAATGG - Intergenic
978240236 4:106506322-106506344 TGGTAGATGAGAAAGCTGGAAGG + Intergenic
978295981 4:107205731-107205753 TGGTAGATGAATGAGGTAGAAGG - Intronic
978573647 4:110166759-110166781 GGGTTGATGAAAAAGGAAGACGG - Intronic
979712994 4:123802847-123802869 GGGAAGAAGAGGAAGGAAGACGG - Intergenic
979987100 4:127328541-127328563 TGAAAGCTGAGTAAAGAAGATGG - Intergenic
981786385 4:148483857-148483879 TGGAAGATGAGGAAGGTAAATGG + Intergenic
982736966 4:159017109-159017131 TGTTAGATGGGAAAGGAAAAAGG + Intronic
983993146 4:174147106-174147128 TGGTAGAAGAGAAAGGCAAATGG + Intergenic
984459913 4:180020994-180021016 TGTTTGATGATTAAGAAAGAAGG - Intergenic
985330580 4:188827836-188827858 TTGTGGATGAGCAAAGAAGATGG + Intergenic
986133862 5:4956218-4956240 GGGAACTTGAGTAAGGAAGAAGG + Intergenic
986255491 5:6100017-6100039 TGGAAGTTGAGAAAGAAAGATGG + Intergenic
986718490 5:10541034-10541056 TGGTAGGTGAGTGAGGGTGAGGG - Intergenic
989354515 5:40528420-40528442 TAGTAGAGGAGGAAGGAAGATGG - Intergenic
989510941 5:42287021-42287043 TGGTAGAAGACTAAGGAAGCAGG - Intergenic
990628154 5:57637599-57637621 TGGGAGACAAGTAAGGAAGTTGG + Intergenic
990862560 5:60343260-60343282 GGGTAGATGAGAATGGAAGGTGG + Intronic
992417613 5:76566821-76566843 TGGGAGATGACCAAGGAGGAGGG + Intronic
993062025 5:83050078-83050100 AGGTATATGAGAAAGGAAAAGGG + Intergenic
994249684 5:97521309-97521331 TGTTTGGAGAGTAAGGAAGAGGG - Intergenic
994703728 5:103172512-103172534 TAGAAGAGGAGAAAGGAAGAAGG - Intronic
994826264 5:104716820-104716842 TGGTAGATAAGAAAGGAAGAGGG - Intergenic
996857579 5:128027025-128027047 TGATAGAGGAGTAGAGAAGACGG + Intergenic
998647967 5:144084928-144084950 TGGTAGATCATCAAGGGAGAGGG - Intergenic
998975863 5:147646036-147646058 TGGGAGAAGAGCAAGGAAAAAGG + Intronic
1004180873 6:13379412-13379434 TGGTACATGAGAATGGAGGAAGG + Intronic
1006256037 6:32832942-32832964 GGAAAGAAGAGTAAGGAAGAGGG - Intronic
1007465141 6:42046394-42046416 TGGTAGATGAGTAAGGAAGATGG - Intronic
1008313002 6:50001180-50001202 GGGAAGGAGAGTAAGGAAGAGGG + Intergenic
1008693459 6:54006918-54006940 TGGTAGGTGAGGAAGGGAGGAGG - Intronic
1008874965 6:56315650-56315672 AGGGAGAGGAGGAAGGAAGAGGG - Intronic
1010577366 6:77549165-77549187 TGGTAGCTGAGGTGGGAAGATGG - Intergenic
1010684037 6:78831078-78831100 TGATAGGTGAGTAAGGGAGATGG + Intergenic
1010846517 6:80715828-80715850 TGGTAGATGAGAAAAAATGATGG + Intergenic
1011366619 6:86589121-86589143 TGATATTGGAGTAAGGAAGAGGG + Intergenic
1011650714 6:89503877-89503899 TGGTAGAGGAGCAAGGAGGCTGG + Intronic
1012138802 6:95594413-95594435 TGGTAGATGAATTAGGAAAAGGG + Intronic
1012662470 6:101919640-101919662 TGTTAAGTGATTAAGGAAGAAGG + Intronic
1013655027 6:112237709-112237731 TGTTTGAAGAGTAAGGATGAAGG - Intronic
1013791041 6:113836875-113836897 AGGTAGCTGTGTTAGGAAGATGG - Intergenic
1014167119 6:118238028-118238050 TCTAAGATGAGAAAGGAAGAGGG - Intronic
1018875638 6:167820039-167820061 TGGTAGATGACAAATAAAGAGGG - Intergenic
1019774590 7:2905125-2905147 TGGCAGATCAGAAAGAAAGAAGG - Intergenic
1019896527 7:3987735-3987757 TGGAAGGTGAGTCAGGAAGAGGG - Intronic
1020360283 7:7320374-7320396 GGGTCTATGAGTAGGGAAGAGGG - Intergenic
1020464920 7:8466616-8466638 TAGTATATCATTAAGGAAGATGG + Intronic
1021055329 7:16040566-16040588 TGATAGATGAGTCAGGGAGAGGG - Intergenic
1022145356 7:27533131-27533153 TGGTAGATTAGAAAGAAGGAAGG - Intronic
1023689693 7:42773068-42773090 TGGTTGGTAAGAAAGGAAGAAGG - Intergenic
1024977671 7:55128889-55128911 TGGCAGTTGAGTAATGAAAATGG - Intronic
1025531085 7:61884714-61884736 TGGGAGCTGATTAAGGAAAATGG - Intergenic
1026103526 7:67402356-67402378 TGGCAGAGGGGTAAGGAAGCAGG - Intergenic
1027358039 7:77378847-77378869 AGGTAGATGAGTAAAGAATAAGG + Intronic
1028127915 7:87135805-87135827 AGGTAGAGGACTATGGAAGAGGG - Intergenic
1028241117 7:88421882-88421904 TGGTAGAGGAGCAAGACAGAAGG + Intergenic
1028272447 7:88809374-88809396 TGGTAGATTGGTAAGTAAGTAGG - Intronic
1028650977 7:93150558-93150580 GGCTAGATGGGTAAGGAGGATGG - Intergenic
1029688789 7:102166593-102166615 TGGCAGCTGAGGCAGGAAGAAGG - Intronic
1032254858 7:130289042-130289064 TGACAGATGAAGAAGGAAGATGG - Intronic
1032538565 7:132684883-132684905 TGGTGGATGAGTGGGGAAGAGGG - Intronic
1032753061 7:134861891-134861913 AGGAAGATGTGTAATGAAGAAGG + Intronic
1032886417 7:136144257-136144279 TGGAAGACTAGTAAGAAAGAAGG - Intergenic
1033309609 7:140251354-140251376 TGGAAGATGAGTATCAAAGAAGG - Intergenic
1033685909 7:143641310-143641332 TGGAAGGAGTGTAAGGAAGATGG + Intronic
1033689834 7:143726005-143726027 TGGAAGGAGTGTAAGGAAGATGG - Intronic
1033698704 7:143816311-143816333 TGGAAGGAGTGTAAGGAAGATGG - Intergenic
1034633856 7:152551846-152551868 TGGCAGATAGGTATGGAAGAAGG + Intergenic
1035814165 8:2520990-2521012 TGGTTGAAGAGGAAGGAAGACGG - Intergenic
1036115789 8:5959429-5959451 TGGTAGAGAAGAAAGGGAGATGG + Intergenic
1036170710 8:6481555-6481577 TGGGAGAGGAGGAGGGAAGACGG - Intronic
1037290848 8:17347980-17348002 TGGTAGAGCAGAAAGGTAGAAGG + Intronic
1040298456 8:46175550-46175572 TGGTCAATGAGGAAGGCAGAGGG + Intergenic
1040589027 8:48772333-48772355 GGGGTGAAGAGTAAGGAAGATGG - Intergenic
1040595124 8:48830677-48830699 TGGAGAATGAGAAAGGAAGAAGG - Intergenic
1042152691 8:65805469-65805491 TGGTAGATTAGCAACCAAGATGG - Intronic
1042398713 8:68320888-68320910 TGGGAGATGAGGAAGGGTGAAGG - Intronic
1042570919 8:70163734-70163756 TGGTAGGTGGGTAAGGGAGACGG + Intronic
1042786754 8:72556293-72556315 TGGTAAAAAAGTAAGGCAGATGG - Intronic
1043822017 8:84878295-84878317 TGGTAGCTGAGTCAGGGAGAAGG - Intronic
1045089342 8:98724282-98724304 TGGTAGAATGGTAAGGTAGATGG - Intronic
1045282348 8:100759956-100759978 AGGAAGACGAGAAAGGAAGAAGG + Intergenic
1045358755 8:101412949-101412971 TGGTGGATTAAGAAGGAAGAGGG - Intergenic
1045476935 8:102561139-102561161 AGGTAGTTGAGTATGGAGGAGGG - Intergenic
1046072624 8:109276394-109276416 TGGTACATGTGTACGAAAGATGG - Intronic
1046798626 8:118399505-118399527 TGGTAGATGAGGGAGGCAGGAGG + Intronic
1050167500 9:2780954-2780976 TGGTGGATTAGCATGGAAGATGG - Intronic
1050812060 9:9760576-9760598 TGATAGCTGAGTAAAGATGATGG - Intronic
1050909372 9:11047810-11047832 TGGAAAGTGAGTAAAGAAGAGGG - Intergenic
1051681793 9:19614856-19614878 TGGTAGATGGGTAGGTTAGAAGG - Intronic
1051741333 9:20255171-20255193 TGGTAAGTGATTAAGGATGATGG - Intergenic
1051911669 9:22159739-22159761 TGGTAAATGAGTGATGAATAGGG + Intergenic
1052532236 9:29701393-29701415 TATTAGATGTTTAAGGAAGAAGG + Intergenic
1052788127 9:32848945-32848967 TGGTTGCTGAGTAAAGAAGATGG - Intergenic
1053946410 9:43313160-43313182 GGGAAGAGGAGAAAGGAAGATGG + Intergenic
1056231061 9:84544939-84544961 TGGCAAAGGAGTAAGCAAGAAGG - Intergenic
1057704912 9:97389405-97389427 TGGCAGATGGGGAAGGTAGAGGG - Intergenic
1057920109 9:99090355-99090377 TGGTAGATCATTAAGGGTGAGGG - Intergenic
1059473942 9:114528775-114528797 TGGTGGAAGAGTAAGCTAGAAGG - Intergenic
1060489501 9:124072112-124072134 GGGTAGATGAATAAGAAGGATGG + Intergenic
1060500387 9:124149346-124149368 TGGTAGATGATTAAGTCATAAGG - Intergenic
1061874765 9:133538208-133538230 TGGGAGTTGAGTAGGGAGGAAGG + Intronic
1203589540 Un_KI270747v1:41718-41740 GGGAAGAGGAGAAAGGAAGATGG + Intergenic
1187019834 X:15369416-15369438 TGGCAAATAAGTTAGGAAGAGGG + Intronic
1188030734 X:25260569-25260591 TGGGAAATGAGTAAAGGAGAGGG - Intergenic
1188245978 X:27836177-27836199 TGGTAAATGAGGAAGGATCAAGG + Intergenic
1188391283 X:29623350-29623372 TGGTATTTGAGAAAGGATGAAGG - Intronic
1189698832 X:43695297-43695319 TGGAAGAAGAGTAAGAAAGTAGG - Intronic
1189701331 X:43717993-43718015 GGGTAGATGTTTTAGGAAGAAGG + Intronic
1190063030 X:47223015-47223037 TGCTAGAGAAGTCAGGAAGAGGG + Exonic
1190521550 X:51283527-51283549 TGGAGGATGAGGAAGAAAGAAGG + Intergenic
1193048107 X:77074116-77074138 GGCTAGATTAGTAAAGAAGAAGG - Intergenic
1193253552 X:79320434-79320456 TGGGAGATGAGGGAGGAAGTGGG + Intergenic
1195175235 X:102308432-102308454 TATCAGATGATTAAGGAAGAGGG - Intronic
1195183630 X:102378661-102378683 TATCAGATGATTAAGGAAGAGGG + Intronic
1196975357 X:121152833-121152855 GAGTAGATGGGTAAGGAGGAGGG - Intergenic
1198665854 X:139022063-139022085 TGGTTGAGGAGTAAGTGAGATGG + Intronic
1198990719 X:142511603-142511625 AGGTAGGTGAATAAGGAAGATGG + Intergenic
1202304706 Y:23456303-23456325 AAGTAGAAGAGTAAGGGAGATGG - Intergenic
1202566104 Y:26214288-26214310 AAGTAGAAGAGTAAGGGAGATGG + Intergenic