ID: 1007467632

View in Genome Browser
Species Human (GRCh38)
Location 6:42065713-42065735
Sequence CTCCCATGACAGATGGTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007467632 Original CRISPR CTCCCATGACAGATGGTCTC GGG (reversed) Intronic
912052843 1:105551798-105551820 CTCCTCTGACAGAAGATCTCTGG - Intergenic
912553420 1:110499091-110499113 CTGCCATGACAGAAGGCCACAGG - Intergenic
912919761 1:113854678-113854700 CTTGCATGACAAATGGGCTCTGG - Intronic
917809663 1:178646124-178646146 CTACCTTCACTGATGGTCTCAGG + Intergenic
918276248 1:182955998-182956020 CCCCAGTGACAGATGGTCACCGG + Intergenic
923839848 1:237657995-237658017 CTCCCATGACAAATGGTCAATGG + Exonic
924077742 1:240358756-240358778 CTCCCATGACACATGGATTATGG + Intronic
1063869269 10:10400608-10400630 CTGCAATGAGATATGGTCTCAGG - Intergenic
1071007753 10:80902060-80902082 CCCCCATTTCATATGGTCTCTGG - Intergenic
1071416862 10:85449623-85449645 CTCCCCTGAGACATGGTTTCTGG - Intergenic
1072118713 10:92387469-92387491 CTCCTCTGACAGATGGTGTGTGG - Intergenic
1072151194 10:92685852-92685874 CTCCCATGAATCATGGCCTCTGG - Intergenic
1073177543 10:101565620-101565642 CTCCCATGCCACACTGTCTCTGG + Intergenic
1073262835 10:102203516-102203538 CTCCCATGATAGGGGGTCCCAGG + Intergenic
1074557519 10:114505454-114505476 CTCCCATGCCAGCTGCTCTGAGG + Intronic
1075011475 10:118874083-118874105 CTCTCATAACTGATGGTCCCAGG - Intergenic
1076666270 10:132094733-132094755 CTCCCACAGCAGATGCTCTCTGG - Intergenic
1077998483 11:7474312-7474334 CTGCCATGACTGAGGGTCACAGG - Intergenic
1078330359 11:10414249-10414271 CTTCCCTGTCTGATGGTCTCGGG - Intronic
1080957058 11:37110489-37110511 ATCCCATTACAGATACTCTCAGG - Intergenic
1083775203 11:64891270-64891292 CTCCCAGGCCAGATGGTGGCGGG - Intergenic
1084106587 11:66984633-66984655 CTCCCATGCCATGCGGTCTCAGG + Intergenic
1086576518 11:88344524-88344546 CCCCTATGACAGGTGCTCTCTGG + Intergenic
1086923859 11:92618364-92618386 AAGCCATGACAGATGGTATCTGG - Intronic
1087511328 11:99098887-99098909 CTGTCTAGACAGATGGTCTCTGG - Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1091628430 12:2140171-2140193 GTCCCAGGACAGAGGTTCTCTGG - Intronic
1092073986 12:5657661-5657683 CTCACATGGCTGAAGGTCTCTGG + Intronic
1092143130 12:6197865-6197887 CTCCCAAGATAGATGGACGCAGG + Intergenic
1096724740 12:53552461-53552483 CTCCCAGTACATCTGGTCTCTGG + Intronic
1096798899 12:54096412-54096434 CTCCCATGACCCATATTCTCAGG + Intergenic
1096805751 12:54140240-54140262 CTCCCATGACCAATGTTCTGGGG - Intergenic
1100861224 12:98809503-98809525 ATCAGATGACAGGTGGTCTCTGG - Intronic
1108699562 13:52932473-52932495 CTGTCATGGCAGATAGTCTCAGG + Intergenic
1108910315 13:55541984-55542006 CTCACATGACAGAAGGTGCCAGG + Intergenic
1110699104 13:78526294-78526316 AAGCCATGACAGATGGTGTCTGG + Intergenic
1112741638 13:102480490-102480512 ATCACATGACAGAGGCTCTCAGG - Intergenic
1113702705 13:112399201-112399223 CTCCCATTACAGCTGGACTTGGG - Intronic
1115879517 14:37899444-37899466 CTGCCATCCCAGATGGGCTCTGG - Intronic
1116996964 14:51334527-51334549 CACCCATTGCAGATTGTCTCTGG + Intergenic
1119203921 14:72779873-72779895 GTCCCAGGACAGAAGGCCTCTGG + Intronic
1125076681 15:35627316-35627338 CTCCCATCAAACATGGTCTGTGG - Intergenic
1125589978 15:40847936-40847958 CTCCCTTGGCAGGTGTTCTCAGG + Intronic
1127817240 15:62621886-62621908 CTCCCAACACAGATGGCCTCAGG + Intronic
1128831422 15:70772730-70772752 CTTCCATGACAGATTTTATCTGG - Intergenic
1132376568 15:101332116-101332138 CTCCCCTGATAGCTGGGCTCTGG + Intronic
1134518671 16:14907514-14907536 CTCCCAGAACAGCTGGTCTAGGG + Intronic
1134555257 16:15158702-15158724 CTCCCAGAACAGCTGGTCTAGGG - Intergenic
1134706342 16:16306167-16306189 CTCCCAGAACAGCTGGTCTAGGG + Intergenic
1134857477 16:17532411-17532433 CTCCCATGTCAGAAGCTCTGTGG + Intergenic
1134871857 16:17659215-17659237 CTCTCATTACAAATGGTCTTTGG + Intergenic
1134961198 16:18405943-18405965 CTCCCAGAACAGCTGGTCTAGGG - Intergenic
1134965500 16:18488546-18488568 CTCCCAGAACAGCTGGTCTAGGG - Intronic
1135337650 16:21617050-21617072 CTCCAAAGACAAATGGTATCTGG + Intronic
1137593265 16:49706867-49706889 CTCACATGGCAGGTGGTCCCAGG + Intronic
1139445439 16:66995453-66995475 TTCCCATGACAGATGGGCCAGGG + Intronic
1140694197 16:77515977-77515999 CTCATATGACAGATGGACTTAGG - Intergenic
1140816823 16:78628871-78628893 CTCCCATTAGTGATGGTCCCAGG + Intronic
1146977171 17:37123580-37123602 TTTCCATGACAGATGGCCTTTGG + Intronic
1148342072 17:46879210-46879232 CTCCCCAGACAGAGGGTTTCCGG - Intronic
1153564411 18:6405309-6405331 CCTCCATAACACATGGTCTCTGG + Intronic
1157273065 18:46291238-46291260 CTCTTATGACAGATGGTGTTGGG + Intergenic
1157313364 18:46568946-46568968 CTCCCAAGACAGAATCTCTCAGG + Intronic
1159442175 18:68495343-68495365 CTCACATGACAGAAGGTGTGAGG + Intergenic
1160584050 18:79903061-79903083 CTTCCAGGAGAGACGGTCTCGGG - Exonic
1162617405 19:11813511-11813533 CTGAAATGAAAGATGGTCTCAGG - Intergenic
1166110526 19:40620051-40620073 CTCACATGCCAGATGCTCTCTGG - Intronic
926754653 2:16225321-16225343 CTCCCCTGACAGATAGCCTAGGG - Intergenic
928068834 2:28194185-28194207 TTCCCAGGACAGATGGTGTTGGG + Intronic
928772499 2:34719475-34719497 CTACCATGGCTGATGCTCTCTGG - Intergenic
934072333 2:88395973-88395995 CTCCCTTAACAGATGGTCCTGGG - Intergenic
936020869 2:108993928-108993950 CTCCCATGGCAGATGGGGTGAGG + Intergenic
936986083 2:118312198-118312220 TTCACATGACAGATGGGATCAGG - Intergenic
938179875 2:129170755-129170777 CTCCCATCACAGGTGGCTTCCGG - Intergenic
940515844 2:154683094-154683116 CTCCCATGGCAGATGGTGGATGG - Intergenic
942898110 2:181082828-181082850 CTCCCAAGGCTGATGGTCTAAGG - Intergenic
945697337 2:213124078-213124100 CATGCATGACAGGTGGTCTCTGG - Intronic
1170847853 20:19977100-19977122 CTCCCTTGAGAGCGGGTCTCTGG - Intronic
1171015337 20:21536393-21536415 CTCCCATGACTGCTGGTAACAGG - Intergenic
1171141905 20:22750657-22750679 CTCTCATGACTTATGGTATCTGG - Intergenic
1172194913 20:33085112-33085134 CACCGCTGACAGATGGCCTCTGG - Intronic
1175772697 20:61633605-61633627 CCACCATGATAGATGGTCTCCGG - Intronic
1178233337 21:30812823-30812845 CTCCCCTGGCTGATGTTCTCTGG - Exonic
1178415156 21:32398641-32398663 CTCCCATCACATCTGGTCTGTGG - Intergenic
1179514618 21:41898112-41898134 TTCCCGACACAGATGGTCTCAGG + Intronic
1183784340 22:40020983-40021005 CTCCCAGGACATATGTTCACAGG - Intronic
1184478780 22:44735612-44735634 CTCCCTTGACGGAGGGCCTCTGG + Intronic
949408770 3:3741630-3741652 CTCCATTGGCAGATGGTTTCAGG - Intronic
949924244 3:9028380-9028402 CCCCCATGTCAGCTGGTGTCTGG - Intronic
952423050 3:33148549-33148571 TTCCCATGACAGCTGGTCATTGG + Intergenic
957908869 3:86595081-86595103 CTCCCATGACACATGCTCCTTGG + Intergenic
958788820 3:98628187-98628209 CTCCCAGGACTGCTGGTCCCTGG + Intergenic
962464675 3:135647034-135647056 ATTGCATGAGAGATGGTCTCTGG + Intergenic
968868170 4:3227166-3227188 ATCCCATGACAGTTGGTTTGCGG - Intronic
969160715 4:5256263-5256285 CATCTATGAAAGATGGTCTCTGG - Intronic
969664785 4:8550990-8551012 CTCCCAGGCCAGCTGGCCTCCGG - Intergenic
970492793 4:16592074-16592096 CCCCCAGTACAGATGGTCTCCGG + Intronic
977213808 4:94254193-94254215 CTGCTTTGACAGATGTTCTCTGG - Intronic
979959796 4:127004072-127004094 ATCCCATGACAGATGGTATACGG - Intergenic
983306972 4:166002190-166002212 CTCACATGTCAGATGGGATCAGG + Intronic
986098263 5:4581593-4581615 CTCCCATGACAAATGGCCTCGGG - Intergenic
993245069 5:85440478-85440500 CTCGCATGAAAGATACTCTCAGG - Intergenic
997201566 5:132012871-132012893 CACTCATGGCTGATGGTCTCTGG - Intergenic
1001413062 5:171524417-171524439 CTCCCATGTCAGATCCTGTCGGG + Intergenic
1001668669 5:173455311-173455333 CTCACATGACTGATGGTCACTGG - Intergenic
1001840228 5:174869786-174869808 CTCAAATAACAGATGGTCTGAGG - Intergenic
1004205314 6:13586964-13586986 CTCCCCTGACAGATGGAACCAGG - Intronic
1007467632 6:42065713-42065735 CTCCCATGACAGATGGTCTCGGG - Intronic
1010604957 6:77876833-77876855 CTCCAATGACAAAATGTCTCAGG + Intronic
1014971244 6:127818046-127818068 CCCCCATGATAGTTAGTCTCTGG - Intronic
1016938545 6:149466266-149466288 CTCCCATCTCGGATGGCCTCTGG - Intronic
1019915724 7:4131041-4131063 CTTCCCTGACACAAGGTCTCAGG + Intronic
1022214359 7:28243542-28243564 AACCCATGACAGAGGGTCCCAGG - Intergenic
1023567316 7:41536394-41536416 CCCCCATGATATATGATCTCAGG - Intergenic
1024403639 7:48952397-48952419 CTCCAATGGCAGATGGTATTTGG + Intergenic
1026035142 7:66825181-66825203 CTCCCATCCCAGCTGCTCTCTGG - Intergenic
1026036925 7:66836622-66836644 CTCCCATCCCAGCTGCTCTCTGG - Intergenic
1026125608 7:67577099-67577121 CTCCCATATCAGAGTGTCTCTGG - Intergenic
1031788450 7:126065975-126065997 CTCCCATGACAGATGGGGATGGG + Intergenic
1032259826 7:130326489-130326511 CACCCATGACAGACTGGCTCAGG + Intergenic
1032395697 7:131588290-131588312 CTCCCATGACAGACACTGTCAGG - Intergenic
1033048899 7:137986514-137986536 CTGCCATGACAGCAGGGCTCGGG + Intronic
1033858332 7:145593652-145593674 TTCCCATGACAAGTTGTCTCAGG + Intergenic
1034222754 7:149459371-149459393 GTGCCCTGACAGATGGTGTCTGG - Intronic
1034958374 7:155350003-155350025 CTCCCAGGACAGAGCGTTTCTGG + Intergenic
1035037418 7:155904175-155904197 GTCCCATGACTGACGGGCTCTGG - Intergenic
1037713562 8:21376344-21376366 ATCCCATGGCTGATGCTCTCTGG - Intergenic
1038825109 8:30991008-30991030 CTCCCATGATGGATGGCTTCTGG - Intergenic
1040317683 8:46273583-46273605 CTCCCATCCCAGAAGCTCTCAGG + Intergenic
1040337891 8:46425399-46425421 CTCCCATCACAGAAGACCTCAGG + Intergenic
1040431766 8:47349860-47349882 AAGCCATGACAGATGGTCCCTGG - Intronic
1042612718 8:70615732-70615754 CTACCAAGACACATGGGCTCTGG + Intronic
1048267649 8:133001604-133001626 CTCACTTGAATGATGGTCTCTGG + Intronic
1049465906 8:142751220-142751242 CTTCCAGGACAGACTGTCTCTGG - Intronic
1050824017 9:9920844-9920866 CTCCCATGATAGATGGAAGCCGG - Intronic
1053788511 9:41669515-41669537 CTCCCATGACCCATATTCTCAGG + Intergenic
1054156628 9:61645253-61645275 CTCCCATGACCCATATTCTCAGG - Intergenic
1054176796 9:61880854-61880876 CTCCCATGACCCATATTCTCAGG + Intergenic
1054476398 9:65576262-65576284 CTCCCATGACCCATATTCTCAGG - Intergenic
1054660739 9:67699952-67699974 CTCCCATGACCCATATTCTCAGG - Intergenic
1056724070 9:89096922-89096944 CTCCCATCACACATTCTCTCTGG - Intronic
1056887107 9:90453765-90453787 TTCCCATGATAGGTGGTTTCAGG - Intergenic
1059447448 9:114347629-114347651 CTCCCCAGACATATGGACTCAGG - Intronic
1060157324 9:121328879-121328901 CTCCCCTCACAGATGGCTTCTGG + Exonic
1060303649 9:122391700-122391722 CTCCCATGACAAATGGTCCCCGG + Intronic
1185666185 X:1767227-1767249 CTCCCATCACAGATGATCCTTGG - Intergenic
1186121164 X:6362533-6362555 CTCCCATGTCAGAGGGTCTTTGG - Intergenic
1187159400 X:16750440-16750462 CTGCCATCATAGATGGTCACAGG - Intronic
1187445897 X:19360778-19360800 CTCCCAGTACAGAAGGGCTCAGG - Exonic
1187476620 X:19616868-19616890 CTCCCATTACTGGTGATCTCTGG + Intronic
1189230209 X:39446205-39446227 CTTCCATGACTGATGGTCATAGG - Intergenic
1189377884 X:40480004-40480026 CTCCCATATCATATGATCTCAGG + Intergenic
1192719620 X:73678476-73678498 CTCCCAGGCCAGATAGTCCCTGG + Intronic
1197868768 X:131046019-131046041 GTGCCAAGACAAATGGTCTCAGG - Intergenic
1198366127 X:135941650-135941672 CCGCCATGACAGATGGTACCTGG - Intergenic
1198703125 X:139418330-139418352 CTGCTATGACAGTTGGTTTCAGG - Intergenic
1199897737 X:152139178-152139200 TTCCCAGGCCAGATGGTCCCTGG + Intergenic
1200939174 Y:8764580-8764602 CTAGAATGACAGATGGTCACTGG + Intergenic
1201393132 Y:13520189-13520211 AACCCATGACAGATGGTACCTGG - Intergenic
1201476946 Y:14392355-14392377 CTCCCATGTCAGGTGGTCTCTGG + Intergenic