ID: 1007468691

View in Genome Browser
Species Human (GRCh38)
Location 6:42073962-42073984
Sequence CTGTGCTAACAGATTGGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007468685_1007468691 9 Left 1007468685 6:42073930-42073952 CCTGCCTGAATTTTGAAGGTAAG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1007468691 6:42073962-42073984 CTGTGCTAACAGATTGGGTATGG 0: 1
1: 0
2: 0
3: 9
4: 114
1007468686_1007468691 5 Left 1007468686 6:42073934-42073956 CCTGAATTTTGAAGGTAAGTCCA 0: 1
1: 0
2: 2
3: 17
4: 174
Right 1007468691 6:42073962-42073984 CTGTGCTAACAGATTGGGTATGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007468691 Original CRISPR CTGTGCTAACAGATTGGGTA TGG Intronic
902181961 1:14696289-14696311 GTGTGCTAACAGATTGGCATAGG + Intronic
902987056 1:20161328-20161350 TAGTGCCAACAGATTGGGTGTGG + Intronic
903918535 1:26782540-26782562 GAGTGCTAACAGATTGGATGTGG - Intergenic
904961098 1:34333628-34333650 ATTTGCTGACAGATTGGATATGG - Intergenic
906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG + Intergenic
909100410 1:71341881-71341903 ATGTGCCAACAGACAGGGTAAGG + Intergenic
909815788 1:79992136-79992158 CTGTGATATCAAATTGTGTAAGG - Intergenic
911486995 1:98514982-98515004 ATGTCCTAACAGATTAGATATGG - Intergenic
913203716 1:116516943-116516965 CTGTGCTAGCTGATAGGGTGGGG - Intronic
920972577 1:210755204-210755226 CTTTGCTAACAGATTAGGTGGGG + Intronic
924703186 1:246474925-246474947 CTGTGCTATCAGATTAAGGAGGG + Intronic
1063707170 10:8441632-8441654 CTGTGCTAGAAAATTGGGTGAGG - Intergenic
1069914813 10:71780912-71780934 ATGTGCTAACTGATTGGCTGTGG + Intronic
1073042442 10:100616850-100616872 CTGTGCTCACAGTTAGGCTATGG - Intergenic
1082013829 11:47469630-47469652 CTGTGCTAACTCACTGGGCAGGG + Intronic
1084082617 11:66838613-66838635 CTGTCCTAACATCTTGGGGAGGG - Intronic
1084967876 11:72753774-72753796 CTGTGTTAACAGAAATGGTAGGG - Intronic
1088795294 11:113262277-113262299 CTGTGCTTAGGGATTGGGGATGG - Intronic
1091063914 11:132491025-132491047 CTTTGCTAACAGATTGGATTTGG - Intronic
1095702550 12:45205310-45205332 CTTTGCTGATAGATTGGATATGG + Intergenic
1095732710 12:45522518-45522540 TTCTGCTACCAGAGTGGGTAGGG - Intergenic
1096351097 12:50902100-50902122 CTGTGCTATCTGGTAGGGTAGGG - Intergenic
1097995524 12:65883662-65883684 CTGTACTAACAGTTTTGCTAAGG + Intronic
1100287094 12:93177335-93177357 CTGTGTTATCAGCTAGGGTAAGG - Intergenic
1102881799 12:116491139-116491161 CTGTGTTAACACAGTTGGTATGG - Intergenic
1107706974 13:43117619-43117641 CTGTGCCAACAGAGAGGGTCAGG - Intergenic
1110200682 13:72846432-72846454 CTGTGCTAAGAGACTGGAGAGGG - Intronic
1110479000 13:75951780-75951802 CTGAGCTGACAGAATGTGTAGGG - Intergenic
1111105030 13:83634044-83634066 CTTTGCTAACAGACAGGGAAAGG - Intergenic
1111688563 13:91531845-91531867 TTGTGCTTCCAGATTGGGAATGG + Intronic
1120944612 14:89982386-89982408 CTGAGCTGCCAGATTGGGTTTGG + Intronic
1122495595 14:102152392-102152414 TTGTGCTAACAGATTATGCAGGG + Intronic
1122724849 14:103743689-103743711 CTGTGCTGGCAGATGGGATAAGG - Intronic
1124380742 15:29162716-29162738 TTCTGCTACCAGAGTGGGTAGGG - Intronic
1128783322 15:70377152-70377174 ATGTGCTAATTGATTGGGCACGG - Intergenic
1129035257 15:72645195-72645217 CTCTGCTACCAGCCTGGGTAGGG + Intergenic
1129214627 15:74092021-74092043 CTCTGCTACCAGCCTGGGTAGGG - Intergenic
1135134466 16:19877360-19877382 GTGTGCTTAGATATTGGGTACGG - Intronic
1138211965 16:55171015-55171037 CTGTTCTAACAGATTGAGAGAGG + Intergenic
1141873623 16:86806558-86806580 ATTTGCTAATGGATTGGGTATGG + Intergenic
1144381121 17:14699305-14699327 CTGAGCTCATAGATTGGGTACGG - Intergenic
1144796309 17:17893626-17893648 CTGTTCCAACAAATTGGGCAAGG + Intronic
1150706162 17:67489262-67489284 CTGTCCTCACAGATGTGGTATGG + Intronic
1150945658 17:69743111-69743133 TTTAGCTAACAGAGTGGGTAAGG + Intergenic
1151178953 17:72311986-72312008 CTCTGCTAACAGACAGGGGAGGG + Intergenic
1155777545 18:29785936-29785958 CTGTGCATGCAGATTGGGTATGG + Intergenic
1156155570 18:34298056-34298078 CTGTGCTTTAAGAATGGGTAGGG - Intergenic
1159509818 18:69381707-69381729 CTCTGTTAACAGATTGGATGTGG - Intergenic
1160267579 18:77353639-77353661 TTCTGCTACCAGAGTGGGTAGGG + Intergenic
1162459468 19:10805954-10805976 GTGTGCTACCTGATTGGGGATGG - Exonic
1167858571 19:52264216-52264238 CTGTCCTCACAGAGTTGGTAGGG + Intergenic
928197148 2:29224092-29224114 CTGTGCTCAGCCATTGGGTAGGG + Intronic
928467109 2:31532612-31532634 CTTTGCTGACAGGTTGGGTTGGG - Intronic
928556393 2:32430588-32430610 CTTTTCTAACAGGTTGGGTTTGG + Intronic
929826884 2:45315813-45315835 CAGGACTAACAGATTGGGTGGGG - Intergenic
932215035 2:69961106-69961128 CTTTGCCAACAGCATGGGTAAGG - Exonic
932916876 2:75868771-75868793 CTGTGGTAACACCCTGGGTAGGG + Intergenic
940610362 2:155982209-155982231 CTGTGCTATCAGACTTGCTATGG + Intergenic
945865915 2:215175409-215175431 AGGTCCTAACAGATTGGGTAAGG + Intergenic
946862528 2:224013943-224013965 CTGGGCTGACAAATTGGATAAGG + Intronic
947474397 2:230430224-230430246 CTGTGCTCTGAGGTTGGGTAAGG + Intronic
1169343546 20:4813366-4813388 CTGTGCAGACAGCTTGGGCAGGG - Intronic
1173645546 20:44631181-44631203 TTGGGCTAACAGATGGGGAAGGG - Intronic
1173921202 20:46746750-46746772 ATTTGCTAACAGATTGGATGTGG - Intergenic
1174406040 20:50304065-50304087 CTGAGACAACAGATTGGATATGG + Intergenic
1175801794 20:61805215-61805237 CTGTTCTAGTAGCTTGGGTAGGG - Intronic
951002089 3:17574482-17574504 CTGTGCTAACAGTGTTGGAAAGG - Intronic
953203752 3:40801571-40801593 CTGTGCTCAGCCATTGGGTATGG + Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
959135261 3:102410831-102410853 CTGTGTTCACAGAGAGGGTAGGG + Intronic
962965192 3:140346896-140346918 CTGTGCTACTAGTTTAGGTAAGG - Intronic
963093597 3:141511108-141511130 ATTTGCTAAGAGACTGGGTATGG + Intronic
967172477 3:186832763-186832785 CTGTGGTCACAGATAGGGGAAGG + Intergenic
971443236 4:26712948-26712970 GTGTGCTACCAGTTTGGATATGG - Intronic
979418101 4:120468646-120468668 ATCTGCTGACAGATTGGATATGG - Intergenic
979422737 4:120526444-120526466 TTTTGCTAACAGACTGGATAAGG + Intergenic
980798436 4:137715259-137715281 CTGTCCCAACAGATTAGGTAAGG + Intergenic
982709177 4:158743143-158743165 ATTTGCCAACAGATTGGATATGG + Intergenic
982757579 4:159240737-159240759 CAGTGCTAACAGAATGGCTTTGG - Intronic
984018029 4:174449270-174449292 CTTGGCTAACATATTGGTTATGG - Intergenic
986048226 5:4061757-4061779 CAGTTCTATCAGATTAGGTAAGG + Intergenic
987670704 5:21003753-21003775 TTGAGATCACAGATTGGGTAGGG - Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
991263345 5:64690166-64690188 CTGGGCAAACAGACTGGGTCTGG - Intergenic
992619081 5:78574711-78574733 CTGTGCTAACAGGTTGCAGATGG + Intronic
992674796 5:79095337-79095359 CTGTGCAAACAGAATGGCTCAGG + Intronic
993364400 5:87018992-87019014 CTGGGCTTACAGAGTGGGCAGGG - Intergenic
995812922 5:116128306-116128328 CTGTGTTAACAGTTTTGGCATGG + Intronic
996252847 5:121358707-121358729 CTGACATAACAGATTGTGTATGG - Intergenic
998946646 5:147347144-147347166 CAGTGCCAACTGATTGGTTATGG + Intronic
1004380615 6:15129171-15129193 CTGTGCTAATAGACTGAGTGGGG - Intergenic
1007468691 6:42073962-42073984 CTGTGCTAACAGATTGGGTATGG + Intronic
1017095457 6:150800727-150800749 CTGTGCTAACAGAGTGTATGAGG + Exonic
1017945197 6:159090904-159090926 CTGTGTTAAAAGATTCGGTCTGG - Intergenic
1019909042 7:4087444-4087466 CTGTGCACACACATTGGTTATGG - Intronic
1022430053 7:30309998-30310020 CTGTGACAACAGTTTGGGGAAGG + Intronic
1028365912 7:90031741-90031763 GTGTGGTAACAGATTGCATAAGG - Intergenic
1028801989 7:94976984-94977006 CTTGGCTAACAGATTGGCTATGG + Intronic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1032599352 7:133276708-133276730 CTGTGCTATGAGATTGGTTAGGG + Intronic
1034749212 7:153553049-153553071 GTGTGTTAATTGATTGGGTAGGG + Intergenic
1038818715 8:30932543-30932565 CTGTGCCATCAAATTGGGAAGGG - Intergenic
1039361043 8:36877167-36877189 CTGGGCTAGCAGTTGGGGTAAGG + Intronic
1039368904 8:36964603-36964625 ATTTGCTAATAGATTGGATATGG - Intergenic
1041570531 8:59333006-59333028 TTCTGCTACCAGAGTGGGTAGGG + Intergenic
1045116372 8:98986857-98986879 CTCTGCTAACATTTTGGGAAAGG - Intergenic
1046517039 8:115276177-115276199 CTGTGCTAAGAGACAGGCTATGG - Intergenic
1047078600 8:121434056-121434078 CTGAGGTAACAGATGGAGTAGGG + Intergenic
1047827747 8:128595887-128595909 ATTTGCTGACAGATTGGATATGG + Intergenic
1047880482 8:129187068-129187090 ATGTGATAACAGATAGGGCAAGG - Intergenic
1048947690 8:139465109-139465131 ATGTGCTGACAGATTGTGCATGG - Intergenic
1050612147 9:7364046-7364068 CTGTGCTAACAGAAGGTGAAAGG + Intergenic
1057926611 9:99157651-99157673 CATTGCTCAGAGATTGGGTATGG + Intergenic
1058254750 9:102747594-102747616 CTGTGCCAACACATTCAGTATGG - Intergenic
1061272606 9:129551854-129551876 CTGTGGGAACAGAGTGGGCAAGG - Intergenic
1187213643 X:17253922-17253944 CTGTGCCAAAAAATTGGGAAAGG + Intergenic
1191811888 X:65197692-65197714 CAGTGTTAACACATTAGGTATGG - Intergenic
1191852412 X:65595274-65595296 CTGTGCTATGAGAGTGGGTATGG - Intronic
1194244897 X:91499109-91499131 CTGTGCTAGGAGCTTGGGAATGG - Intergenic
1195656697 X:107338170-107338192 CTCAGCTAACAGATTTGGTGGGG - Intergenic
1197851056 X:130860607-130860629 ATATGCTAATAGATTGGATATGG - Intronic
1199184153 X:144895620-144895642 ATTTGCTAACAGATTAGATATGG + Intergenic
1200563873 Y:4740419-4740441 CTGTGCTAGGAGCTTGGGAATGG - Intergenic
1200874830 Y:8142704-8142726 ATGGGCTAACAGCTTGTGTAAGG - Intergenic