ID: 1007476389

View in Genome Browser
Species Human (GRCh38)
Location 6:42122516-42122538
Sequence AGGAACCAGGTGGGTAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 407}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007476385_1007476389 -8 Left 1007476385 6:42122501-42122523 CCTTACTGAGAGGGAAGGAACCA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1007476389 6:42122516-42122538 AGGAACCAGGTGGGTAGAGAAGG 0: 1
1: 0
2: 2
3: 32
4: 407
1007476379_1007476389 25 Left 1007476379 6:42122468-42122490 CCTAGATGGAGCTTTGGAGGTTC 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1007476389 6:42122516-42122538 AGGAACCAGGTGGGTAGAGAAGG 0: 1
1: 0
2: 2
3: 32
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007476389 Original CRISPR AGGAACCAGGTGGGTAGAGA AGG Intronic
900591438 1:3462032-3462054 AGGGAACAGTGGGGTAGAGATGG + Intronic
900824847 1:4918298-4918320 AGGAACCTGGTGGGAGGTGATGG - Intergenic
900939219 1:5787022-5787044 AGGGAGCAGGCAGGTAGAGAAGG + Intergenic
902373452 1:16019092-16019114 AGCAAGCAGGTGGGTAGGGAGGG - Intronic
902620588 1:17648521-17648543 AGGAAGGAGGTGGGTAGAGCTGG - Intronic
902874127 1:19330832-19330854 GAGACCCAGGTGGGCAGAGAGGG + Intergenic
903522903 1:23967070-23967092 AGGAAAGAGGTGAGAAGAGATGG + Intronic
903710894 1:25323389-25323411 TGGGACCAGGTGGGTAGGGAGGG - Intronic
903716052 1:25368040-25368062 TGGGACCAGGTGGGTAGGAAGGG + Intronic
904342562 1:29846258-29846280 AGGCAGCAGGAGGGGAGAGACGG + Intergenic
904538111 1:31214813-31214835 AGGACCCAGGTGGCTAGAGCTGG + Intronic
905678486 1:39847803-39847825 AGTAACCTGGTGGGTAGGGGAGG - Intronic
906078581 1:43069154-43069176 AGGCGCCAGGTGGCTGGAGAGGG + Intergenic
906322730 1:44827051-44827073 AGGAAGCTGGTGGACAGAGAGGG - Exonic
906445175 1:45890058-45890080 AGGAACTAGATTGGTATAGATGG - Intronic
906847302 1:49206926-49206948 AGGAACCAGGTGGGCGGAATGGG + Intronic
908892178 1:68860391-68860413 AGGAAAGTGCTGGGTAGAGAAGG - Intergenic
909011773 1:70342799-70342821 GGGAACTAGATAGGTAGAGATGG + Intronic
909680018 1:78281330-78281352 AGGACACAGATGGGTACAGAGGG + Intergenic
910127520 1:83860618-83860640 AGTCCCGAGGTGGGTAGAGAAGG - Intergenic
910839157 1:91545578-91545600 AGGCAGCTGGAGGGTAGAGATGG - Intergenic
911048685 1:93651071-93651093 AGCAACCAGGTAGAGAGAGAAGG + Intronic
912091498 1:106081735-106081757 GGGATCAGGGTGGGTAGAGAGGG - Intergenic
912251194 1:108014152-108014174 AGTAACCAGATGAGAAGAGAAGG - Intergenic
912560566 1:110548473-110548495 AGGAATCAGCAGGGGAGAGAAGG + Intergenic
915167543 1:153956815-153956837 AGGAGCAAGGTGGGTAGAAGGGG + Intronic
915325180 1:155078398-155078420 AGGACTCAGGTGGGCACAGAAGG - Intergenic
916556341 1:165897125-165897147 AGGAACCTGGAGTGTACAGAGGG + Intronic
916600959 1:166293189-166293211 AGGAAACAGGTCGGAAGAAAAGG - Intergenic
917254942 1:173104006-173104028 AGGGAAGTGGTGGGTAGAGAAGG - Intergenic
917503845 1:175610599-175610621 AAGAACCAGGTGTGGGGAGATGG - Intronic
920216656 1:204365952-204365974 CGGAACCAGGTGTGTGGAAATGG + Intronic
922119333 1:222647535-222647557 AAGCACCAGGAGGTTAGAGAAGG - Intronic
922589829 1:226766439-226766461 GGGAACCAGGTGGGGAGGGCAGG - Intergenic
923146945 1:231204683-231204705 AGGAACCAGGTGATCTGAGAAGG - Intronic
923221640 1:231899874-231899896 GGGAAGCAGGGGAGTAGAGAGGG - Intronic
924356619 1:243183913-243183935 AGGAAACTGCTGGATAGAGAGGG - Intronic
1063118788 10:3089851-3089873 AGGAAGCAGGGGTGTAAAGAAGG - Intronic
1063375602 10:5552509-5552531 AGGTCTCAGCTGGGTAGAGATGG - Intergenic
1064031365 10:11885358-11885380 AGGAGATGGGTGGGTAGAGATGG + Intergenic
1064097512 10:12434915-12434937 AGGAATCAGGAGGGGAGGGAAGG + Intronic
1064352255 10:14586828-14586850 AGGAACCTGGTGGGGGTAGAGGG - Intronic
1064357327 10:14631667-14631689 GGGACCCAGGAGGTTAGAGAAGG - Intronic
1064841726 10:19599958-19599980 AGGGCCCAGATGGGGAGAGAAGG + Intronic
1064896777 10:20246173-20246195 AGCAAACAGGTGGGAAGACAAGG + Intronic
1065274622 10:24073428-24073450 CGGAACCAGCTGGATATAGATGG + Intronic
1065287668 10:24201598-24201620 TGGAGCCAAGTGGGTAGAGGGGG - Intronic
1065590858 10:27259445-27259467 AGGGACGAGGTGGGAAGTGACGG - Intergenic
1067028679 10:42866033-42866055 GGGAACCAGGAGGGCAGGGAGGG - Intergenic
1067343079 10:45419742-45419764 AGGCACCAGGGGTGTAGGGAAGG + Intronic
1068144953 10:53057197-53057219 TGGAACTGGGTGGCTAGAGATGG + Intergenic
1068603697 10:58981952-58981974 AGGACCCATCTGAGTAGAGAGGG - Intergenic
1070415293 10:76183631-76183653 AAGATCCATGTGGGTACAGAAGG + Intronic
1070768804 10:79070625-79070647 AGGGACGAGGTGGGAAGGGAAGG - Intronic
1070863604 10:79692699-79692721 GGGAAGCAGGTGGTGAGAGATGG - Intergenic
1071457832 10:85864312-85864334 AGGAAGCAGATGGTAAGAGAGGG + Intronic
1072718964 10:97769300-97769322 TGGAGCCAGGTGGGGAGTGATGG - Intronic
1073045555 10:100635767-100635789 AGGGACAAGGTGGGCACAGAGGG - Intergenic
1073627743 10:105117199-105117221 AGGAAACAGGGAGGGAGAGAAGG - Intronic
1074006286 10:109427774-109427796 AGGAACAATTTGGGTGGAGAGGG + Intergenic
1074764020 10:116687276-116687298 AGGATGCAGGTGGGAAGCGAAGG + Intronic
1075842134 10:125513907-125513929 AGGGACTAAGTGGCTAGAGAAGG + Intergenic
1076839502 10:133039128-133039150 AGGGACCAGGCGGGCAGAGGGGG - Intergenic
1076888103 10:133271745-133271767 AGGTACGAGGTGGGTGGGGAAGG - Intronic
1077138887 11:1014846-1014868 AGGAACCAGCTGGGAGGGGAGGG - Intronic
1077473279 11:2774808-2774830 AGGTAGCAGGTGGGCAGGGAGGG + Intronic
1077782583 11:5347760-5347782 AGGAAGGAGGTAGGGAGAGAGGG + Intronic
1078473650 11:11611905-11611927 AGGAACCTGGAGGGTAGGGTGGG - Intronic
1078502717 11:11898573-11898595 AGGCACTTGGTGGATAGAGAGGG + Intronic
1078949322 11:16111789-16111811 ACAAACCAGGTAAGTAGAGAGGG - Exonic
1078949628 11:16115613-16115635 GGAAAACAGGTGGCTAGAGAAGG + Intronic
1079437024 11:20466424-20466446 AGGAACCAGGATGGTAGTAAAGG - Intronic
1079443140 11:20535160-20535182 AGGGACCAGGTGACGAGAGAGGG - Intergenic
1079996475 11:27300193-27300215 AGGCACGAGGTGGGTAGTGGGGG - Intergenic
1080395489 11:31886171-31886193 AGGAAGCTGCTGGGAAGAGACGG + Intronic
1080760214 11:35241566-35241588 AGGCACCAAGTGGTCAGAGACGG + Intergenic
1081462660 11:43286349-43286371 AGGAAAGTGATGGGTAGAGAAGG + Intergenic
1083321206 11:61848143-61848165 AGGCACCCTGTGGGGAGAGAGGG - Exonic
1083433755 11:62629029-62629051 AGGAAGCAGGTTGGAAAAGAGGG + Intronic
1084234278 11:67776431-67776453 GGGAATCAGATGGGTAGAAAAGG - Intergenic
1087009196 11:93497575-93497597 AGGAACACTGAGGGTAGAGACGG + Intronic
1087127332 11:94640860-94640882 AGGAGACAGGTGGGAAGAGGGGG - Intergenic
1088113429 11:106288608-106288630 ATTAGCCTGGTGGGTAGAGAAGG + Intergenic
1088843206 11:113643950-113643972 AGGAAGCAAGAGGGAAGAGAGGG + Intergenic
1090260442 11:125315162-125315184 AGGAAGGAGGTGGGGAGAGGGGG - Intronic
1090607818 11:128441386-128441408 AGGAACCTGGTGGGACGACATGG + Intergenic
1090630577 11:128643921-128643943 TGGAAACAGGTGGGGAGAGAGGG - Intergenic
1090635687 11:128689400-128689422 AGGAACCTGGGGGGTACACAAGG - Intronic
1090747903 11:129721774-129721796 AGGAACCAGTGGGGTAGTGTGGG - Intergenic
1092997263 12:13962227-13962249 AGGAACCAGGCGGGAGCAGAGGG + Intronic
1093503204 12:19836018-19836040 AGGGACGAGCTGGGTAGAGGAGG + Intergenic
1094053673 12:26246859-26246881 GGGAACGTGGTGGGTAGAGGAGG + Intronic
1094480422 12:30876906-30876928 AGACACAAGGTGGGTAGGGAGGG + Intergenic
1095252170 12:39991579-39991601 AGCACCCATGTGGGAAGAGAGGG - Intronic
1096709057 12:53442192-53442214 AGGAACCAAGTAGGTATTGAGGG + Intronic
1099068277 12:78012002-78012024 AGGGACCTGGTGGGAAGTGATGG - Intronic
1099366465 12:81771360-81771382 TGAAACCAGGTGGGTTGTGATGG - Intergenic
1100811061 12:98338829-98338851 AGGCACCAGGCTGGTAGGGATGG - Intergenic
1101718550 12:107331896-107331918 CGGACCCAGGTGGGGAGAGGTGG - Intronic
1101770842 12:107749530-107749552 AGAAACTAGGTAAGTAGAGAAGG - Intronic
1102524507 12:113502003-113502025 TGCAACCAGGTGGGTAAGGAAGG - Intergenic
1103017843 12:117509361-117509383 AGGAGCCAGGTGGTGAGATAAGG + Intronic
1103197663 12:119059178-119059200 AGGGACAGGGTGGGTAGGGAAGG - Intronic
1103792027 12:123478713-123478735 AGAAGACAGGTGGGTATAGAGGG - Intronic
1104303913 12:127592127-127592149 AGGAAAAAGGTGGGAAGAAAAGG + Intergenic
1104443696 12:128816239-128816261 AAAATCCAGGTGGGCAGAGAAGG - Intronic
1107052761 13:36069648-36069670 AGGATCCAGGTGGGAAGAGGTGG - Intronic
1107716547 13:43205306-43205328 AGGAAGGAAGTGGGGAGAGAAGG - Intergenic
1107798906 13:44084825-44084847 AGGATGCAAGTGGGTAGAGAAGG - Intergenic
1109195699 13:59375730-59375752 AGGACCCAGGTGGATAAGGAGGG - Intergenic
1109256372 13:60088420-60088442 AGGAAGCAGAGGGGCAGAGAGGG - Intronic
1110171205 13:72502740-72502762 AGGAACAAGGGAGGGAGAGAGGG + Intergenic
1110520175 13:76466469-76466491 AGGCACTAGGTGTGTAGTGATGG - Intergenic
1110889821 13:80684813-80684835 AGGACCTGGGTGGGTACAGAAGG + Intergenic
1112894211 13:104278425-104278447 AGGAACTAGGTGGGAGGTGATGG - Intergenic
1113608064 13:111624315-111624337 AGGGACCCGGTGGGGAGAGCAGG - Intronic
1113723007 13:112574930-112574952 AGGGCCCAGGTGGGGAGGGAGGG + Intronic
1115651111 14:35403793-35403815 AGGAACCTGTGGGGAAGAGAGGG + Exonic
1116225609 14:42148100-42148122 AGCAACCATGTGGGTAAGGAGGG - Intergenic
1116574152 14:46551757-46551779 AGGAAGCCAGTGGTTAGAGAGGG - Intergenic
1117715420 14:58575137-58575159 AGGACCCAGATGGGTGAAGAGGG - Intergenic
1118626864 14:67667434-67667456 AGGAAACAGGTTGGTTGAGAGGG - Intronic
1119435872 14:74597516-74597538 AGGACACAGGTGTGGAGAGAGGG + Intronic
1119860924 14:77935527-77935549 AGGAAGTAGATGGGTAAAGAAGG + Intergenic
1119991838 14:79207037-79207059 AGGAAGCAGCTGGGGAGGGATGG - Intronic
1121219887 14:92277426-92277448 AGGAACCAAGGGGCTAGAGAAGG - Intergenic
1122636058 14:103130229-103130251 AGGAAACAGGCGGGAACAGAGGG - Intronic
1123975669 15:25552195-25552217 AGGAAACAGATTGGTAGTGAGGG + Intergenic
1125602520 15:40923407-40923429 AGGATCCAGGTGGGGAGGCAAGG + Intergenic
1125932491 15:43610506-43610528 AGGAACCATGGGGGTGGAAAGGG + Intronic
1125945589 15:43709978-43710000 AGGAACCATGGGGGTGGAAAGGG + Intergenic
1126376458 15:48001731-48001753 AAGAAGGAGGTGGGTAGAAAGGG + Intergenic
1127064517 15:55222810-55222832 AGGAAGCAAGTGGGTTGAGAAGG - Intronic
1127773265 15:62247015-62247037 AGGAACCAGGTGGGTAAGCTGGG - Intergenic
1127896095 15:63300179-63300201 AGAAACCAGATGGCTCGAGATGG - Intronic
1129069054 15:72936149-72936171 AGGAAAGAGCTGGGAAGAGAAGG - Intergenic
1129629057 15:77236774-77236796 AGGGACCTGGTGGGAAGTGATGG + Intronic
1129892059 15:79077994-79078016 AGGACCCAGCTGGGGAGAGCTGG - Intronic
1129993929 15:79988724-79988746 AGAGAGAAGGTGGGTAGAGAAGG + Intergenic
1131747697 15:95467364-95467386 AGAAACCTGATGTGTAGAGAGGG - Intergenic
1131973228 15:97913800-97913822 AGGTACCAGGGAGGGAGAGAGGG - Intergenic
1132176579 15:99720706-99720728 AGTAACCAGCTGAGAAGAGAAGG - Intronic
1133662068 16:7927962-7927984 TGGAACAAGATGGGTAGAAAAGG - Intergenic
1134366352 16:13582793-13582815 AGGAACCCGGGGCTTAGAGAAGG + Intergenic
1134433949 16:14237678-14237700 AGAAACCAGTTGAGTAGGGAAGG + Intronic
1136000529 16:27289069-27289091 AGAAACCAGGAGGGTAGGTATGG + Intronic
1136394688 16:29986650-29986672 AGGAAGCAGTTGGAGAGAGAAGG + Exonic
1137350222 16:47706979-47707001 AGAAAACTGGTAGGTAGAGAAGG + Intergenic
1138528275 16:57621084-57621106 GGGAGCCAAGTTGGTAGAGAGGG - Intronic
1138991614 16:62397115-62397137 AGGAAGCAGGGAGGGAGAGAGGG + Intergenic
1140496574 16:75394188-75394210 AGGAGTCAGGTGGGTAGTCAGGG + Intronic
1140916359 16:79497376-79497398 AGGAAGCAGGCGGGTGGAGTGGG - Intergenic
1141146147 16:81531528-81531550 ACTAACCATGCGGGTAGAGACGG - Intronic
1141660630 16:85439296-85439318 ATGACCCAGGTGGCCAGAGAGGG + Intergenic
1141875973 16:86824852-86824874 GGGAACCCGGTGGGTGGGGATGG - Intergenic
1142495392 17:303739-303761 AGGAAAGAGGTGGGGAGGGAGGG + Intronic
1142496023 17:306781-306803 AAGAAGCAGGTGGGGAGGGAGGG - Intronic
1142762143 17:2049039-2049061 AGGAGCCGGGTGGGGAGTGAAGG + Intergenic
1143033348 17:3980475-3980497 AGGACCTCGGAGGGTAGAGACGG + Intergenic
1143338061 17:6188398-6188420 TGCAACCAGGGGGATAGAGATGG + Intergenic
1143374526 17:6459374-6459396 AGGAACCAGGAGGAGAGTGAGGG - Intronic
1143725598 17:8843078-8843100 AGGGACCAGGTGGGCAGATGTGG - Intronic
1144295896 17:13874836-13874858 AGGAACCAGATGAGTAGTGTGGG + Intergenic
1146676545 17:34777230-34777252 AGAAACCAGGTGGGAAAAGGAGG - Intergenic
1146845272 17:36178468-36178490 AGGAACCTGGTGGGAGGGGATGG - Intronic
1146873487 17:36390311-36390333 AGGAACCTGGTGGGAGGGGATGG - Intronic
1147065901 17:37922562-37922584 AGGAACCTGGTGGGAGGGGATGG + Intergenic
1147149706 17:38507583-38507605 TGGAACCAGCTGGGATGAGAGGG + Intronic
1148488196 17:48004865-48004887 GGGAGGGAGGTGGGTAGAGAAGG + Intergenic
1148690418 17:49523964-49523986 AGGCACCAGGTGGGGGGAGGGGG - Intergenic
1148814640 17:50318787-50318809 AGGATTCAGGAGAGTAGAGATGG + Intergenic
1148866793 17:50632983-50633005 AGGAAGCCGGTGGGTAGACAAGG + Intergenic
1148964340 17:51422209-51422231 AAGAACCAGGTGGAGATAGAGGG - Intergenic
1149328309 17:55555766-55555788 AGGGACCGAGTGGGGAGAGAGGG - Intergenic
1149620757 17:58043278-58043300 AGGAAACAGGTGGGCAAAGGAGG + Intergenic
1149772080 17:59330677-59330699 AGGCACCAGGTGGGTGGAGTGGG - Intergenic
1150139773 17:62717830-62717852 AGGATCTGGGTGGGAAGAGATGG - Intronic
1151580244 17:74973302-74973324 GGGAATCTGGTGGCTAGAGAGGG - Intergenic
1151871639 17:76840779-76840801 AAGAGACAGGTGGGGAGAGAGGG - Intergenic
1153010464 18:534179-534201 AGGTGCCAGGTGAGCAGAGAGGG - Intergenic
1155333171 18:24738322-24738344 AGAAAGCAGGTGGGTAGAGAAGG + Intergenic
1155372539 18:25117186-25117208 AGGAAAGAGCTTGGTAGAGATGG - Intronic
1155606359 18:27610641-27610663 TGGAAGCAGGTGGATAGATACGG + Intergenic
1157726884 18:49971239-49971261 GGGAAGGAGGTGAGTAGAGAGGG + Intronic
1159122809 18:64190414-64190436 AGGAACCTGGTGGGTGGTAACGG - Intergenic
1160521965 18:79512955-79512977 ATGAGCCAGGTGGGTACGGAAGG - Intronic
1160797077 19:950520-950542 AGCAGCCAGGTGTGTACAGATGG + Intronic
1161507237 19:4650500-4650522 AGGAAGGAGGTGGGTGGAGGGGG + Intronic
1161759286 19:6159438-6159460 AGCAGCCAGGTGGGTGTAGAGGG - Intronic
1164529812 19:29039866-29039888 CGTAAGCAAGTGGGTAGAGAAGG + Intergenic
1165126276 19:33600212-33600234 AGCAAGCAGGTAGGGAGAGAAGG + Intergenic
1165164283 19:33840538-33840560 AGGAGGCAGGGAGGTAGAGACGG + Intergenic
1166118467 19:40670103-40670125 AGGATCCAGGTCAGAAGAGAGGG - Intronic
1166271391 19:41716427-41716449 GGGAACGAGGTGTGTGGAGAAGG + Intronic
1166330408 19:42075238-42075260 AGGAACGAGGTGAGTAGGAATGG + Intronic
1166496528 19:43306850-43306872 AGGAAGCAGCTGGGTAGAGGGGG - Intergenic
1166799720 19:45449138-45449160 AGGAAGCAGAGGGTTAGAGAAGG + Intronic
1167019537 19:46863092-46863114 AGGAACTAAATGGGAAGAGAAGG - Intergenic
1167057192 19:47119033-47119055 TGGAACCAGGGAGGTAGAGGTGG - Intronic
1167106831 19:47435319-47435341 AGAAACCAGGTGGTTAGATCAGG - Intronic
1167162047 19:47774354-47774376 AGGAGCCAGGGGCTTAGAGAGGG + Intergenic
1167779951 19:51592804-51592826 AGAAACCAGGTGGGGTGAGTGGG + Intergenic
1168195282 19:54770146-54770168 AGGAACCTGGAGGGGAGATATGG + Intronic
1168316904 19:55488509-55488531 AGGAGGCAGCTGGGGAGAGAGGG - Intronic
1168722482 19:58561823-58561845 AGGAACCACGTGGTTACAGAGGG + Intergenic
1202694082 1_KI270712v1_random:112031-112053 GGGAACCAGGAGGGTAGGGAGGG - Intergenic
925049241 2:798267-798289 AGGAAAGGGCTGGGTAGAGAAGG - Intergenic
925996432 2:9297234-9297256 AAGAACCTGGTGGGGAGTGAGGG + Intronic
926060793 2:9803463-9803485 AGGGGGCAGGTGGGGAGAGAGGG - Intergenic
926215127 2:10901676-10901698 TGGATGGAGGTGGGTAGAGAAGG - Intergenic
926312804 2:11686587-11686609 AGGAACAGGGTGGGTAGCCATGG + Intronic
927381144 2:22480397-22480419 AGGTCCCATGAGGGTAGAGATGG - Intergenic
929044243 2:37775024-37775046 AGGAGCAAAGTGGGTACAGATGG + Intergenic
930032772 2:47068661-47068683 AGGGATAAGGTGGGTAGGGAGGG - Intronic
930144913 2:47992003-47992025 AGAAAACAAGTGGGTTGAGAGGG + Intergenic
931243122 2:60470094-60470116 AGGAGCCTGGTGGGTAACGATGG + Intronic
931437037 2:62256542-62256564 AGGAACCAGGTGGGAGGTGATGG + Intergenic
931634311 2:64328061-64328083 AGGAGCCGTGTGGGCAGAGAAGG - Intergenic
932445510 2:71778554-71778576 AGGAACCAGGCTGATAGAGCAGG + Intergenic
932559477 2:72854856-72854878 AGGAGCCAGGTGCAGAGAGATGG - Intergenic
932962841 2:76435276-76435298 AGCACCCAGCTAGGTAGAGAGGG + Intergenic
933952478 2:87342544-87342566 GGGAACCAGGAGGGTAGGGAGGG + Intergenic
934060289 2:88286140-88286162 AGGACCCCAGTGGGTAGGGAAGG + Intergenic
934093659 2:88577816-88577838 AGGAGACAGGTGGGGAGGGATGG - Intronic
934236718 2:90238881-90238903 GGGAACCAGGAAGGTAGGGAGGG + Intergenic
934663531 2:96155397-96155419 AGGGGCCTGGTGGGTGGAGAAGG - Intergenic
935076870 2:99753887-99753909 AGGCACCAGCAGGGCAGAGATGG - Intronic
935558797 2:104539886-104539908 AGGAAACAGGTTGGTGGTGATGG - Intergenic
935863743 2:107362731-107362753 AGGGATCAGGTGGGATGAGAAGG + Intergenic
936487846 2:112942145-112942167 AGCAAGCAGGTGAGTAGAGTTGG + Intergenic
936776313 2:115977730-115977752 CGGATCCAGGTGGATATAGATGG + Intergenic
937391060 2:121487037-121487059 AGGAACCTGGAGGGGAGAGCAGG - Intronic
937956403 2:127423811-127423833 AGGAAGCAAGGGGGTAAAGAGGG - Intronic
939617941 2:144381231-144381253 AGGAAGCAGCAGGGTACAGAAGG + Intergenic
939873221 2:147548069-147548091 AGGTCCCAGGTTGGTAGTGATGG + Intergenic
941325435 2:164109002-164109024 AGGAAAGTGCTGGGTAGAGAAGG + Intergenic
942832161 2:180250361-180250383 AGGAAGAAGTTGGGTTGAGAGGG - Intergenic
942927987 2:181456837-181456859 AGGAAGGAAGTGGGTATAGAAGG + Intergenic
943753559 2:191535275-191535297 AGGAACCAGTTAGTTTGAGATGG + Intergenic
944192263 2:197015772-197015794 AGAAACCAAGGGGGTAGATATGG + Intronic
945256389 2:207807003-207807025 GGGAAGCAGGTGGGAAGGGAGGG - Intergenic
945442244 2:209894079-209894101 AGGGACAAGTTGGGGAGAGATGG + Intronic
948613069 2:239181697-239181719 AGCAAGCAGGTGGGTGGAGCAGG - Intronic
948987049 2:241532282-241532304 AGGAAACAGGTGTGGAGGGATGG - Intergenic
1169262355 20:4148518-4148540 AGAAGCCAGGAGGGTAGAGGTGG - Intronic
1169424549 20:5485790-5485812 AGGATCCAGGAGAGTGGAGAAGG - Intergenic
1169647598 20:7831192-7831214 AGGAAAGAGGTGAGAAGAGATGG + Intergenic
1170730994 20:18974631-18974653 AGGAGTCAGGTGGGAAGAGCAGG + Intergenic
1171199466 20:23229647-23229669 GGGAACCTGGTGTGTTGAGAGGG + Intergenic
1172037409 20:32019479-32019501 AGGAACCTGGTGGGTGGGGCGGG - Intronic
1173233544 20:41222149-41222171 ATGGACCAGGATGGTAGAGATGG + Intronic
1173443181 20:43095891-43095913 AGGAGAGAGGTGGGGAGAGAGGG - Intronic
1173443210 20:43096011-43096033 AGGAGAGAGGTGGGGAGAGAGGG - Intronic
1173753081 20:45491965-45491987 AGTAAACAGGTGGATCGAGATGG + Intergenic
1174212632 20:48892022-48892044 TGGCACCTAGTGGGTAGAGACGG - Intergenic
1174330241 20:49812228-49812250 AGGAACAAGGTGAGGTGAGAGGG - Intergenic
1175812666 20:61867052-61867074 AGGAACCAGCAGGAGAGAGACGG + Intronic
1176019993 20:62957615-62957637 TGGCACCAGGTGGGGAGACAAGG + Intronic
1176257291 20:64158933-64158955 AGGAAGCAGGTGGGTGCAGGGGG - Intronic
1177193913 21:17882263-17882285 ATGAATCAGGTAGGTAGAGCTGG - Intergenic
1177930554 21:27277764-27277786 AGGCACCAGGTCAGTAGAAAAGG - Intergenic
1180000600 21:44993718-44993740 GGGAAGGAGGTGGGTGGAGATGG - Intergenic
1180157108 21:45983142-45983164 AGGGTCCAGGTGGTTAGTGAGGG - Intronic
1180645756 22:17337502-17337524 AGGGACCAGGCTGCTAGAGATGG - Intergenic
1181949320 22:26542686-26542708 AGGAAACAGGCAGGTGGAGAAGG + Intronic
1182394461 22:30025464-30025486 AGGAACAAGCTGGGTAGGGAGGG - Intronic
1182994272 22:34798548-34798570 AGGAACCTGGAGGGGAGCGAGGG + Intergenic
1183180573 22:36257417-36257439 AGGAACCAGCAGGGAAGAGGAGG - Intronic
1183467365 22:37986483-37986505 AGGAAGCAGGGAGTTAGAGAGGG - Intronic
1184072107 22:42152794-42152816 AGGAACCGGGTGGGCGGAGCTGG - Intergenic
1184257200 22:43294131-43294153 ATGAAGCAGGTGGGAAGAGGGGG + Intronic
1184949840 22:47833436-47833458 AGGAATCAGGTGGCTAGAGAGGG + Intergenic
1185138259 22:49086092-49086114 AGGGACCTGGTGGGAAGTGATGG + Intergenic
1203296358 22_KI270736v1_random:46411-46433 AGGAGCAAAGTGGGTACAGATGG + Intergenic
950100716 3:10355039-10355061 GGGAACCAGGGGGCTAGAGGGGG + Intronic
950311262 3:11960070-11960092 AGGAAGGAGGTAGGTAAAGATGG + Intergenic
950634127 3:14303219-14303241 AGGAGCCAGGTAGGTGGAAAGGG - Intergenic
951467914 3:23021708-23021730 AGGAACCTGGTGGGAGGTGATGG - Intergenic
952107285 3:30085072-30085094 CAGAACCAGCTGGGTAGATAGGG - Intergenic
952962942 3:38604206-38604228 AGGAACCAGGTGGGTTGGGCCGG + Intronic
953194351 3:40718216-40718238 AGAAACAGGGTGGGGAGAGAGGG + Intergenic
953814523 3:46143706-46143728 AGGAAGCAAGAGGGTTGAGAAGG + Intergenic
953819403 3:46191731-46191753 ATGCTCCAGGTGGGTAGAGCAGG + Intronic
953857782 3:46514330-46514352 AGGAAACATGTGGGTGGGGAGGG + Intergenic
954450856 3:50570993-50571015 TGGACCCAGCTGGGTGGAGATGG - Exonic
955484817 3:59424709-59424731 GGGTACCAGCTGGGTAGAGAAGG + Intergenic
955529421 3:59857863-59857885 AGAAACCAGGTGGTGAAAGAAGG + Intronic
956309001 3:67858541-67858563 AGGAAGGAGGTGGGTGGAGGAGG + Intergenic
956528440 3:70190230-70190252 GGGAAACAGGAGGGAAGAGATGG - Intergenic
956735343 3:72233616-72233638 AGGAAAGTGCTGGGTAGAGAAGG - Intergenic
957479325 3:80770911-80770933 AGGAAAGCGCTGGGTAGAGAAGG - Intergenic
957595282 3:82257053-82257075 AGGGAGAAGGTGGGTAGAGAGGG + Intergenic
959937198 3:112041464-112041486 AGGGACAAAGTGGGTAGAGGGGG - Intronic
961766028 3:129211817-129211839 AGGCAACTGGTGGGAAGAGAGGG - Intergenic
961801512 3:129453747-129453769 GGGTACCAGGTGGGTTGGGAAGG + Intronic
961833560 3:129638304-129638326 AGGCACAATGTGGGCAGAGATGG + Intergenic
961977263 3:131039558-131039580 AGGAACCAGATCGGTTTAGAAGG - Intronic
963500318 3:146117532-146117554 AGTAACCAGGAGGTTAAAGAGGG - Intronic
964495922 3:157289663-157289685 AGGACCCAGAAGGGTAAAGAAGG - Intronic
965388024 3:168069569-168069591 AGAAGCCATATGGGTAGAGAAGG + Intronic
968568383 4:1326891-1326913 AGGACCCAGGTCGGTAGGGCGGG - Intronic
968789778 4:2651595-2651617 AGGAACCTGGTGGGAGGTGATGG - Intronic
969607781 4:8211146-8211168 AGAAAACAGGTGGGGGGAGAGGG - Intronic
969820869 4:9719325-9719347 GGGAATCAGATGGGTAGAAAAGG + Intergenic
970488178 4:16545140-16545162 AGGAAGCAGGGAGGGAGAGAGGG - Intronic
972380735 4:38517689-38517711 AGGAAGCAGGTTTGAAGAGATGG + Intergenic
975854093 4:78604437-78604459 AGTAAGGAGATGGGTAGAGAAGG - Intronic
976099888 4:81550395-81550417 TGGAACCAGGTGGGGAGTCAGGG - Intronic
976562970 4:86522809-86522831 AGGAACAAAGTGGGGAGAGTTGG - Intronic
976649986 4:87423872-87423894 AGGTACCAGATGGGTAGACTGGG + Intronic
978851340 4:113340581-113340603 AGGAACCAGGGAGGTTGAGGCGG + Intronic
978885476 4:113761958-113761980 AGAAACCAGGTGGGTGGAGGAGG + Intergenic
979245199 4:118495692-118495714 AGGAAACTGCTGGATAGAGAGGG + Intergenic
979349494 4:119628191-119628213 GGGAACCAGAGGGCTAGAGAGGG + Intronic
979550832 4:121989054-121989076 GGGTACCAGGTGGGAACAGAGGG + Intergenic
980703661 4:136463641-136463663 AGGAAACAGTTGGGAAGAGTTGG - Intergenic
981138402 4:141238749-141238771 AGAACCCAGGAGTGTAGAGATGG - Intergenic
981353742 4:143763093-143763115 AGGACACAGGTAGGTACAGAAGG - Intergenic
981616259 4:146647852-146647874 AGGAACCAGAGGGGTGGAGAGGG - Intergenic
982338856 4:154272466-154272488 AGGCACCAGGTGGGAGGTGATGG + Intronic
982918772 4:161249022-161249044 GGGATCCAGGTGGGTAGTGTGGG - Intergenic
985831888 5:2240085-2240107 ATGGACCAGATGGCTAGAGAAGG + Intergenic
986079529 5:4375716-4375738 AGGAAACAGCTGGGTACAGACGG - Intergenic
986319747 5:6620459-6620481 AGGAACCAGGTGGCTCTGGATGG + Intronic
987004227 5:13692819-13692841 AGGGAGCATGTGGGTGGAGATGG - Intronic
989526049 5:42454827-42454849 AGGAACCTTGTGGGCAGACAGGG - Intronic
990368676 5:55095015-55095037 AGGAATGAGGTGGGTACAGGAGG + Intergenic
992308262 5:75465845-75465867 AGGAAAAGGGGGGGTAGAGAAGG + Intronic
993526250 5:88969327-88969349 AGGAAAGATGTGGGTAGAGAAGG - Intergenic
994327142 5:98461593-98461615 AGGGGAAAGGTGGGTAGAGAGGG + Intergenic
994733085 5:103517346-103517368 AGCAATCAAGTGGATAGAGAAGG + Intergenic
994746773 5:103687729-103687751 AGGCACCATGTGGGGAGAGAGGG + Intergenic
996012590 5:118497696-118497718 AAAAACCAGGTGGGCAGTGAAGG + Intergenic
997759064 5:136427478-136427500 AAGAGCCAGGTGGTTAAAGAAGG - Intergenic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998434761 5:142098105-142098127 GAGAACAAGGTGAGTAGAGAAGG - Intergenic
998527838 5:142858880-142858902 AGTAACTAGGTGGGGAGACAGGG + Intronic
998674836 5:144395724-144395746 AGGACCATGGTGGGAAGAGATGG - Intronic
999134741 5:149311167-149311189 AGGAAGGGGCTGGGTAGAGAGGG - Intronic
999318476 5:150599251-150599273 AAGAACCAGGTCCTTAGAGAAGG + Intergenic
999696636 5:154192890-154192912 TAGACCCAGATGGGTAGAGAAGG + Intronic
1000629106 5:163571798-163571820 ATGTACCAGGTGGGGACAGATGG - Intergenic
1001108741 5:168877631-168877653 AGGAAGCAGGAGGGCAGACACGG + Intronic
1002383239 5:178845671-178845693 AGGAACCAGAAGGGTAAAGGGGG + Intergenic
1003234043 6:4280721-4280743 AGAAACAAGGTGGGTGGAGGTGG - Intergenic
1004159522 6:13201147-13201169 AGGAACTAGCTGGGAAGACAGGG + Intronic
1005228788 6:23674618-23674640 AGGATCCAGTTGGATGGAGAGGG - Intergenic
1005825428 6:29628922-29628944 AGGAAACAGGTAGGGAGGGAAGG + Intronic
1005844015 6:29763361-29763383 AGGGACCAGGAGGGGAGAGGAGG + Intergenic
1006285318 6:33088910-33088932 AGGGACCAGGTGGAAAGGGATGG - Intergenic
1006872748 6:37267718-37267740 TAGAAGCAGGTGGGAAGAGAGGG - Intronic
1007476389 6:42122516-42122538 AGGAACCAGGTGGGTAGAGAAGG + Intronic
1007848105 6:44777652-44777674 GGGAATTAGGTGGCTAGAGATGG - Intergenic
1008382962 6:50854684-50854706 AGGAATCAGCTGGATAGAAAAGG - Intergenic
1008772273 6:54992821-54992843 AGGACCAAGCTGGGTAGAGTTGG - Intergenic
1009989646 6:70826279-70826301 GGGAACCAGGAGATTAGAGATGG + Intronic
1011409102 6:87047729-87047751 AGTTACCAGGTGAGTACAGATGG - Intergenic
1011738801 6:90338814-90338836 AGGAATCAAGGGGGTAGAAATGG + Intergenic
1012089758 6:94876136-94876158 AGGAGACAGTAGGGTAGAGAAGG + Intergenic
1013189074 6:107786600-107786622 CTGAACCAGGTGGGGATAGATGG - Intronic
1013455047 6:110322911-110322933 AGGAACTGGGTGGGAGGAGAAGG + Intronic
1015116442 6:129654749-129654771 AGGATCCAGGTGTGTAGCGATGG - Intronic
1015576078 6:134672585-134672607 AAGAACCTGTGGGGTAGAGATGG + Intergenic
1015786408 6:136923737-136923759 AGGAATCCGGTGGGCAGAGCTGG + Intronic
1016124505 6:140384482-140384504 AGGAACCTGGTGGGTGGTGATGG - Intergenic
1016606751 6:145937676-145937698 AGAGACTAGGTAGGTAGAGATGG - Intronic
1016841863 6:148533256-148533278 AGAAACCAGGTGTGTGGAGCAGG - Intronic
1019191603 6:170254398-170254420 AAGAACCAGGTGGGAAGTGGAGG + Intergenic
1019546880 7:1582153-1582175 AGTGACCAGGTGGGCACAGAGGG - Intergenic
1021489039 7:21198264-21198286 AGGAACCAAGTGAATAGAAAAGG + Intergenic
1021645125 7:22782310-22782332 AGGGTCCAGGCGGGTAGCGATGG - Intergenic
1022404356 7:30073352-30073374 AGGAAACAGATGGTTAGAGAGGG + Intronic
1023379443 7:39591837-39591859 AGGAATTAGGTAGGGAGAGAGGG - Intronic
1024377906 7:48659800-48659822 AAGAACCAGGTGAGCAGTGAGGG - Intergenic
1026470172 7:70688323-70688345 AGAAACCAGGTGAGTTCAGAAGG + Intronic
1026929368 7:74215357-74215379 AGGCAGGAGGTGGGCAGAGAGGG + Intronic
1027471715 7:78582277-78582299 AGCAACCACGTGGGAAGTGAAGG + Intronic
1027703085 7:81493452-81493474 AGGAAGGAAGGGGGTAGAGAAGG + Intergenic
1028271503 7:88796565-88796587 AGAAACCAGGAGAGGAGAGAAGG - Intronic
1028466907 7:91162658-91162680 AGGAACCAGAAGTGTAGAGAGGG - Intronic
1029525234 7:101089787-101089809 AGGAGGCAGGTGGGTGGAGGGGG + Exonic
1029554190 7:101256643-101256665 AGAAACCAGGTGGCTGGAAAGGG + Intergenic
1031411872 7:121449015-121449037 AGGAAGCAAGTAGCTAGAGATGG - Intergenic
1031914260 7:127547410-127547432 AGGAACCTGGTGGGAGGTGATGG - Intergenic
1032842335 7:135724177-135724199 GGGAAGGAGGTGGGGAGAGAAGG + Intronic
1033261198 7:139845336-139845358 AGGCACCAGGTGAGAAGCGAGGG - Intronic
1033770546 7:144546580-144546602 AGGAACCTGGTGGGAGGTGACGG + Intronic
1034078233 7:148252774-148252796 AGGAAGCAGGTGGGGAGCCAGGG - Intronic
1034279695 7:149844473-149844495 TGTACCCAGGTGGGGAGAGATGG + Intronic
1034551262 7:151822261-151822283 AGGAACGAGGTGGGTTCAGGAGG + Intronic
1034592211 7:152150974-152150996 AAGCACCAAGAGGGTAGAGAAGG - Exonic
1034689431 7:153002188-153002210 AGGGACCTGGTGGGAAGTGATGG - Intergenic
1034875465 7:154721010-154721032 AAGAACCAGGTGGGGACGGAAGG - Intronic
1034938996 7:155218417-155218439 AGGAAACAGGTGTGCAGGGAGGG + Intergenic
1035171144 7:157018062-157018084 GGGAGCCGGGAGGGTAGAGAGGG + Intergenic
1035673530 8:1438181-1438203 AAGAACCAGGTGGCTAGCGCTGG - Intergenic
1037002805 8:13741133-13741155 AGGAGACAGGAGGGTAAAGAGGG + Intergenic
1037309472 8:17539285-17539307 AGGAATAAGGTGCGTAGAAATGG + Intronic
1037737807 8:21581204-21581226 AGGACCCTGGAGGGTAGAGCAGG - Intergenic
1038051901 8:23821829-23821851 AGGAATCAGATGGTTGGAGAAGG - Intergenic
1038202323 8:25424843-25424865 GGGAACCTGGTGGGTAGATGAGG - Intergenic
1038428353 8:27479906-27479928 AGGAACGAGTGGGGCAGAGAGGG - Intergenic
1040610663 8:48978352-48978374 AAGAACCAGGTGAGTCGAGCTGG - Intergenic
1040890387 8:52311077-52311099 AGCAAACAGGTGAGTAGTGAAGG + Intronic
1041606980 8:59793129-59793151 AGGAAGGAGGTGGGAAGAGTGGG + Intergenic
1042088314 8:65132281-65132303 AGGAACAAGGGGGATAAAGATGG - Intergenic
1044182183 8:89209688-89209710 AGAAACCATGGTGGTAGAGATGG - Intergenic
1044582755 8:93838466-93838488 AGGAAGCAGGTGGCCAGAGTAGG + Intergenic
1046405822 8:113770527-113770549 AGGAACCTGGTGGAAAGTGATGG + Intergenic
1047307870 8:123667799-123667821 AGGAAGCAGGTGGTCAGATAGGG + Intergenic
1048405139 8:134111394-134111416 AGGAACTGGGTGGGTAGTGGTGG - Intergenic
1049417022 8:142499942-142499964 AGGAACCGGGTGGGCATTGAGGG - Intronic
1052550140 9:29937883-29937905 AGTTACTAGGTGGGTAGGGAAGG + Intergenic
1054848602 9:69822744-69822766 AGGAACCTGGTGAGGAGAGAAGG + Intronic
1056476504 9:86957197-86957219 AGGAAACAGGTGGGGGGAGTAGG - Intergenic
1056660297 9:88538260-88538282 AGGAATCAGGAGGGTGGAGGTGG - Intronic
1058297722 9:103329453-103329475 AGGAACCAAGGGGGGAAAGAAGG - Intergenic
1059398930 9:114056668-114056690 AGGGCCCAGGTGAGTGGAGATGG + Intergenic
1059405013 9:114094064-114094086 AGGAAGCAGGTGGGGACATAAGG + Intronic
1059457754 9:114410512-114410534 AGGCAGCAGGTGGGGACAGAAGG + Intronic
1059504198 9:114782984-114783006 AGAGACCAGGTGGGGAGAGGAGG + Intergenic
1060200247 9:121648324-121648346 ATGCACCAGGTGGGTGCAGAGGG + Intronic
1060702276 9:125766295-125766317 AGGATCCAGGTAGGTAGCTATGG - Intronic
1061870402 9:133517265-133517287 AGTCACCTGGTGGGGAGAGAGGG - Intronic
1186148726 X:6651673-6651695 TGGAAGCAGGTGGGTAAAGGAGG - Intergenic
1186925252 X:14326558-14326580 ATGAACTAAGTGGGGAGAGATGG + Intergenic
1187434414 X:19253867-19253889 ATGAAGTAGGTGGGTAGGGAGGG + Intergenic
1188169654 X:26909234-26909256 AGGACCCATGTAGTTAGAGATGG - Intergenic
1190337834 X:49273324-49273346 AGGGCCAAGGTGGGTGGAGAGGG + Intronic
1190584622 X:51926688-51926710 AGGGTCCAGATGGGTAGGGAAGG + Intergenic
1190746547 X:53326564-53326586 AGGCAGCAGGTGGGTAAAGAAGG - Intergenic
1193520874 X:82527961-82527983 AGTCAGCAGGTGGGTAGAGCTGG + Intergenic
1195422207 X:104688063-104688085 AGGAGCCTGGCGGGGAGAGATGG - Intronic
1195424983 X:104718444-104718466 AGGGACCTGGTGGGAAGTGATGG + Intronic
1196376571 X:115039777-115039799 AGGAAAGTGCTGGGTAGAGAAGG + Intergenic
1197164960 X:123366784-123366806 AGTCAGCAGGTGGTTAGAGAAGG + Intronic
1197841478 X:130752196-130752218 AGGAAACAGATGGGGAGGGAGGG - Intronic
1198029078 X:132737522-132737544 AGCAACACGGTGGGGAGAGATGG + Intronic
1200076204 X:153552443-153552465 AGGATTCAGGTGGGGAGAGGAGG - Intronic
1200108880 X:153728978-153729000 AGAAACAAGGTGACTAGAGAGGG + Intronic
1200691655 Y:6311296-6311318 AGAATCCAGGTGGGCACAGATGG + Intergenic
1201043617 Y:9863428-9863450 AGAATCCAGGTGGGCACAGATGG - Intergenic