ID: 1007476938

View in Genome Browser
Species Human (GRCh38)
Location 6:42125187-42125209
Sequence GCTTCTATGTAGCAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007476931_1007476938 6 Left 1007476931 6:42125158-42125180 CCGCCTGGTCCTGGAAGGAGAAG 0: 1
1: 0
2: 2
3: 72
4: 365
Right 1007476938 6:42125187-42125209 GCTTCTATGTAGCAGGTGGAGGG 0: 1
1: 0
2: 0
3: 16
4: 129
1007476934_1007476938 -3 Left 1007476934 6:42125167-42125189 CCTGGAAGGAGAAGGAAAAAGCT 0: 1
1: 0
2: 5
3: 44
4: 469
Right 1007476938 6:42125187-42125209 GCTTCTATGTAGCAGGTGGAGGG 0: 1
1: 0
2: 0
3: 16
4: 129
1007476933_1007476938 3 Left 1007476933 6:42125161-42125183 CCTGGTCCTGGAAGGAGAAGGAA 0: 1
1: 0
2: 7
3: 87
4: 509
Right 1007476938 6:42125187-42125209 GCTTCTATGTAGCAGGTGGAGGG 0: 1
1: 0
2: 0
3: 16
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007476938 Original CRISPR GCTTCTATGTAGCAGGTGGA GGG Intronic
901129685 1:6954563-6954585 GCTACTATGTACCAGGTGCAAGG - Intronic
904088345 1:27927035-27927057 GATGCTATGTAGCAGGTTGATGG - Intergenic
906602216 1:47139876-47139898 GCTGCTCTGTGGCAGATGGAAGG + Intronic
907143877 1:52214525-52214547 GAATGTATGTAGTAGGTGGATGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
912123971 1:106510048-106510070 GTGTCCATGTAGCAGGTGGGAGG + Intergenic
913158159 1:116120670-116120692 CCTACTATGTAGCAGGTGCCAGG - Intronic
913581000 1:120226637-120226659 GCTTCTCTGAGGCAGGTTGAGGG + Intergenic
913627178 1:120671763-120671785 GCTTCTCTGAGGCAGGTTGAGGG - Intergenic
914562930 1:148838074-148838096 GCTTCTCTGAGGCAGGTTGAGGG + Intronic
914609897 1:149292148-149292170 GCTTCTCTGAGGCAGGTTGAGGG - Intergenic
915580212 1:156808905-156808927 GCCTCGATGTGGGAGGTGGAGGG + Intronic
921706000 1:218323603-218323625 GCTTCTGGGTAGAAGGGGGAGGG - Intronic
922098587 1:222463344-222463366 GCTTATATGTTTCAGGTGGAAGG + Intergenic
922786174 1:228283367-228283389 GCTGCTCTGTCTCAGGTGGAAGG + Intronic
1063660764 10:8034146-8034168 GCTCCTAGGTGGCAGGTGGAAGG - Intergenic
1066245062 10:33574762-33574784 GGTTCTATGTAGCAGAAGGGGGG - Intergenic
1070231703 10:74574251-74574273 GCTTCAATGTCGGAGGTGGATGG - Intronic
1070257083 10:74822169-74822191 GATTCCATGTGGCAGTTGGAAGG + Intergenic
1071390910 10:85174614-85174636 GCTTCCAGGATGCAGGTGGAAGG - Intergenic
1073117456 10:101099595-101099617 GCCACAATGTGGCAGGTGGAGGG + Intronic
1073285315 10:102383985-102384007 GCCCCTATGTAGCTGCTGGATGG + Intergenic
1074447581 10:113533241-113533263 GCTTCCAGGGAGCAGCTGGAAGG + Intergenic
1074873164 10:117593786-117593808 GCTGGTATATAGAAGGTGGATGG + Intergenic
1078715621 11:13836499-13836521 GCTACTTTGTAGCAGGGAGAAGG - Intergenic
1079186281 11:18240300-18240322 GATTTCATGGAGCAGGTGGAAGG + Intronic
1080117500 11:28637274-28637296 GCTTCTCTGTAGCATCTGGTTGG - Intergenic
1083209007 11:61171029-61171051 GATTCTATGGAGTAGGAGGAAGG - Intergenic
1085277860 11:75311650-75311672 GCCTGTGTGTGGCAGGTGGAGGG - Intronic
1086775709 11:90830273-90830295 GCTCCTATGGAGCATTTGGATGG + Intergenic
1087150467 11:94855069-94855091 GCCTTTATGTAGCTGGTGAAGGG + Intronic
1087418434 11:97888668-97888690 GCTTTTAGGTAGAAGGGGGAAGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091111598 11:132974022-132974044 GCTTCTCCATAGCAGCTGGAGGG - Intronic
1091225180 11:133952896-133952918 TCTTCTAGGAAGCAGGTGGAAGG + Intronic
1093568760 12:20641116-20641138 ATTCCAATGTAGCAGGTGGATGG - Intronic
1095092462 12:38119990-38120012 GATTCTATGTAGCAGGCTTAAGG - Intergenic
1096945820 12:55408844-55408866 GCTTTTAGGTAGAAAGTGGAAGG + Intergenic
1097697940 12:62792714-62792736 GCTTCTAGGGAGGAGGGGGAGGG - Intronic
1098128180 12:67321557-67321579 GCTTTGCTGTACCAGGTGGATGG + Intergenic
1099050290 12:77774304-77774326 GCTTCCATGAAGCAGTAGGATGG + Intergenic
1101520758 12:105479930-105479952 GCTACTATGTAGTGGGTAGAGGG + Intergenic
1108546545 13:51501024-51501046 CCTCCTAAGTTGCAGGTGGAGGG + Intergenic
1110548080 13:76779226-76779248 GATTCTATGATGAAGGTGGAAGG - Intergenic
1111139684 13:84099800-84099822 GCTTCTGAGTAGCAAGAGGATGG + Intergenic
1112408570 13:99142452-99142474 ACTTCTAAGTGGGAGGTGGAAGG + Intergenic
1112988569 13:105482370-105482392 ACTTCTAAGTAGCATGAGGAAGG + Intronic
1116400634 14:44502477-44502499 GCTTGTATGTATGGGGTGGAGGG + Intergenic
1117798457 14:59418842-59418864 GCATCTCTGAAGCAAGTGGATGG + Intergenic
1118767369 14:68918845-68918867 GCTTCTATGTGGCAGATCCAGGG - Intronic
1122337668 14:101004549-101004571 GCATCTATGGAGCAGTGGGAGGG - Intergenic
1122895573 14:104755098-104755120 GCAACTCTGTAGCAGGTGAAGGG + Intronic
1128874958 15:71194366-71194388 GCTTCTCAGTAGCAGGTGGCTGG - Intronic
1129174058 15:73827167-73827189 GCTCCTACCTACCAGGTGGAGGG + Intergenic
1130228165 15:82075826-82075848 GCTTCCATGCAGCAGGTAGCAGG + Intergenic
1135466591 16:22691649-22691671 GTTTCCATGTAGCAGTTGGCTGG - Intergenic
1137559413 16:49493191-49493213 GCTTGAAGGTAGCAGGAGGATGG - Intronic
1141724864 16:85781181-85781203 GCTTCTGTGCAGCATGTGGGAGG - Intronic
1145934662 17:28707876-28707898 GCTGCCATGTTGCAGGTGGCTGG - Intronic
1145939509 17:28735225-28735247 GCTTCTATCCTGCAGGTGGTGGG + Exonic
1147214679 17:38892348-38892370 GCTTCTGTGCCGCAGGTGGGTGG - Intronic
1147772835 17:42879517-42879539 GCTTCTTTCTTGAAGGTGGAAGG - Intergenic
1151329804 17:73400083-73400105 CCATCTACGCAGCAGGTGGAGGG + Intronic
1154030403 18:10748539-10748561 TCTTCTTTGCAGCAGGAGGAAGG + Exonic
1154163390 18:11996393-11996415 GCCTCTACGCAGCAGCTGGATGG - Intronic
1155234306 18:23804165-23804187 GCTTATATGTAGACGGTGGCAGG + Intronic
1156499035 18:37545318-37545340 GCTACTAGGCAGCAGGAGGAAGG - Intronic
1157446915 18:47753130-47753152 GCTGGCATGTGGCAGGTGGAGGG - Intergenic
1158823683 18:61190172-61190194 GTGTCTATGTTGCAGGGGGATGG + Intergenic
1161192943 19:2969414-2969436 GCTTCTTTCTACCAGGTGGCAGG + Intergenic
1163852952 19:19676521-19676543 CCTTCTGAATAGCAGGTGGATGG - Intronic
925817679 2:7769155-7769177 GCTTCTAAATAGGAGATGGAGGG + Intergenic
926271816 2:11372369-11372391 TCTTCTATGTGCCAGGTGCAGGG - Intergenic
927506599 2:23619085-23619107 GCCTCTCTGTTGCAGGTGGGAGG + Intronic
928942689 2:36742538-36742560 TGTTCTATGTAGGATGTGGAAGG - Intronic
930781200 2:55225765-55225787 GCTTCCAGGTAGCAGTTGGTGGG + Intronic
939913357 2:148009860-148009882 TCTTATATGTAGCAGGTAGTAGG - Intronic
944518131 2:200532731-200532753 TCATCTATGTACCAGGTGCAGGG - Intronic
944794110 2:203164942-203164964 GCTTGAATCTGGCAGGTGGAGGG - Intronic
945595927 2:211792620-211792642 GCTTCTCTGTAGCATATGCAAGG - Intronic
948120177 2:235523824-235523846 GCTTGGACGTAGCAGGGGGACGG + Intronic
1168955348 20:1830550-1830572 GCCTCTATGCAGCTGGGGGAAGG + Intergenic
1169557338 20:6765424-6765446 CATTCTAAGTTGCAGGTGGAAGG + Intergenic
1170198485 20:13716083-13716105 GCTTCTAAGTAGCATATAGAAGG - Intronic
1172906133 20:38370867-38370889 GCTTCTCTGTAGCTGGTGGGAGG + Intronic
1180123245 21:45768068-45768090 GCTTCTGTCTTGCAGGTGGCTGG + Intronic
1182757778 22:32694290-32694312 GCTTATATGTGGCAGGGGAAGGG - Intronic
1183489384 22:38108548-38108570 GCATCTAAGAAGCAGGGGGATGG + Intronic
949908654 3:8881703-8881725 GCTTCTGTTTAGCATGTAGAGGG + Intronic
951349784 3:21592925-21592947 GCTGCCCTGTAGCAGGTGTAGGG - Intronic
956665555 3:71638869-71638891 CCTTCCATATAGCAGGTGGCAGG - Intergenic
956879033 3:73491705-73491727 GCTACTCTGTAGGAGGTGGGAGG - Intronic
956913731 3:73848820-73848842 GCTTCTATAGAGCAGGTGAATGG + Intergenic
957550529 3:81697786-81697808 CCTGCTTTGGAGCAGGTGGAAGG + Intronic
961379164 3:126486192-126486214 GCCTCTAGGCAGCAGGTGGGTGG - Intronic
964812247 3:160678327-160678349 GCTCCTATGTAACAGCTGGGTGG + Exonic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
965906624 3:173715547-173715569 ATTTCTATGTATCAGGAGGAAGG + Intronic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
976273402 4:83252213-83252235 TCTTCTAGGGAGCAGGGGGACGG + Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
979414955 4:120425644-120425666 GGTTATATGTTGCAGGTGGATGG + Intergenic
985980308 5:3457020-3457042 GCTCCTTTGTGGCATGTGGAAGG - Intergenic
989268703 5:39506703-39506725 GCTTCTATGCAGCTGATGGAGGG - Intergenic
990608818 5:57437333-57437355 GATGCTGTGTAGCAGGTGGATGG + Intergenic
992105339 5:73445670-73445692 GCTACTATGTTGCAGATGGAAGG - Intronic
993488671 5:88518603-88518625 TCTTTTATGTAGCATGTGGTAGG - Intergenic
997430155 5:133832105-133832127 GCTTGTCTGAAGCTGGTGGAGGG + Intergenic
1000843721 5:166253349-166253371 GCTTCTATGTTGCAGGAGAATGG + Intergenic
1002046757 5:176545847-176545869 GCTGCCTTGTGGCAGGTGGATGG + Intronic
1002288953 5:178186716-178186738 GCTTGTATGCTGCAGCTGGATGG - Intergenic
1007422435 6:41727845-41727867 GCTTCCAAGTGGCAGGTGGGTGG + Intronic
1007476938 6:42125187-42125209 GCTTCTATGTAGCAGGTGGAGGG + Intronic
1007717705 6:43866791-43866813 TCTTCTCTGTAGCAGCTGGAAGG - Intergenic
1010203188 6:73300146-73300168 CCTTCCATGTAGCAGGTGTGTGG - Intronic
1012023877 6:93962986-93963008 CATTCTATGTAGCAGGAGCAAGG + Intergenic
1015853481 6:137599110-137599132 GCTTCTAAGTGCCAGTTGGAGGG + Intergenic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1018319900 6:162596897-162596919 TCTTGTATGTAGGAGGTGGCGGG - Intronic
1019648405 7:2143127-2143149 GCCTCTATGGAGCCTGTGGACGG - Intronic
1022768308 7:33440509-33440531 GCTACTGTGTAGCACATGGAAGG + Intronic
1024167217 7:46746902-46746924 GCTTCTATTTCCCAGGAGGAGGG - Intronic
1024731219 7:52255935-52255957 GGTTCTCTGCAGCAGGTGAATGG + Intergenic
1027504831 7:79003184-79003206 GTGTGTATGTAGCAGGTGGTGGG + Intronic
1029528221 7:101108508-101108530 GCAGCTCTGCAGCAGGTGGAAGG - Intergenic
1030365155 7:108637393-108637415 ACTTCTCTCCAGCAGGTGGATGG + Intergenic
1030754514 7:113271819-113271841 TCTTGTAGGCAGCAGGTGGATGG - Intergenic
1031256612 7:119459083-119459105 GTTTATAGGTAGCAAGTGGAAGG + Intergenic
1037833418 8:22202060-22202082 GGATCTATGTACCAGGTGGGTGG - Intronic
1039576719 8:38629515-38629537 GTTTCAATGGAGCAGGTAGAAGG + Intergenic
1043486613 8:80704500-80704522 GCTTCTATGTTGCTTCTGGATGG + Intronic
1043551527 8:81378551-81378573 GCTTATATCTAGCTGGTGTATGG + Intergenic
1045975227 8:108123624-108123646 TCTTGTATGTAGCACCTGGATGG - Intergenic
1049382152 8:142322266-142322288 GCCTCTCTGTATCAGGTTGAGGG - Intronic
1049815083 8:144595442-144595464 GCTTCTCTGTGGGAGGTGGATGG + Intronic
1051686536 9:19663933-19663955 CCTTCTAATAAGCAGGTGGATGG + Intronic
1052997351 9:34558206-34558228 GCCTCCATTGAGCAGGTGGAGGG - Intronic
1056204285 9:84305338-84305360 GCTTTTATGTTGCAGGTGTTTGG - Exonic
1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG + Intronic
1062176455 9:135165922-135165944 GCTCCTAAGCACCAGGTGGAAGG - Intergenic
1189047497 X:37609194-37609216 ATTTCTTTTTAGCAGGTGGAAGG - Intronic
1193425417 X:81336678-81336700 GCTTCGATCCAGCAGGGGGAGGG + Intergenic
1193486155 X:82087277-82087299 GCAACTATGTTGCTGGTGGAAGG - Intergenic
1194685616 X:96910370-96910392 GCTTCTATGTATATTGTGGATGG + Intronic
1195443541 X:104923887-104923909 TCTTATAGGTAGCAGGTGGTTGG - Intronic
1197149827 X:123207997-123208019 GCTTCTGAGCAGCAGGAGGAAGG - Intronic