ID: 1007478809

View in Genome Browser
Species Human (GRCh38)
Location 6:42136722-42136744
Sequence TGGGACTTGCTGGGAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 292}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007478809_1007478824 28 Left 1007478809 6:42136722-42136744 CCAGTCTTTCCCAGCAAGTCCCA 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1007478824 6:42136773-42136795 GCCTTTGTCCAAGGGCAGAGGGG 0: 1
1: 0
2: 3
3: 20
4: 172
1007478809_1007478821 20 Left 1007478809 6:42136722-42136744 CCAGTCTTTCCCAGCAAGTCCCA 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1007478821 6:42136765-42136787 AGAGAGAGGCCTTTGTCCAAGGG 0: 1
1: 1
2: 1
3: 26
4: 202
1007478809_1007478817 6 Left 1007478809 6:42136722-42136744 CCAGTCTTTCCCAGCAAGTCCCA 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1007478817 6:42136751-42136773 CTGACCTGAGGACCAGAGAGAGG No data
1007478809_1007478820 19 Left 1007478809 6:42136722-42136744 CCAGTCTTTCCCAGCAAGTCCCA 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1007478820 6:42136764-42136786 CAGAGAGAGGCCTTTGTCCAAGG No data
1007478809_1007478822 26 Left 1007478809 6:42136722-42136744 CCAGTCTTTCCCAGCAAGTCCCA 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1007478822 6:42136771-42136793 AGGCCTTTGTCCAAGGGCAGAGG 0: 1
1: 0
2: 1
3: 23
4: 333
1007478809_1007478823 27 Left 1007478809 6:42136722-42136744 CCAGTCTTTCCCAGCAAGTCCCA 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1007478823 6:42136772-42136794 GGCCTTTGTCCAAGGGCAGAGGG 0: 1
1: 0
2: 1
3: 100
4: 390
1007478809_1007478813 -6 Left 1007478809 6:42136722-42136744 CCAGTCTTTCCCAGCAAGTCCCA 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1007478813 6:42136739-42136761 GTCCCAGCAGGCCTGACCTGAGG 0: 1
1: 0
2: 5
3: 24
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007478809 Original CRISPR TGGGACTTGCTGGGAAAGAC TGG (reversed) Intronic
902684467 1:18066916-18066938 GGGGAGATGCTGGGGAAGACGGG + Intergenic
902919636 1:19658124-19658146 TGGGACTTGCGTGGACAGTCAGG + Intronic
903289457 1:22298780-22298802 TGGGAGAAGCTGGGAAAGAAGGG + Intergenic
903332990 1:22606502-22606524 TGGGACATGGTGGAAAACACTGG - Intergenic
903469443 1:23575611-23575633 TGGGGCTTGCTGAGAGAGCCGGG + Intergenic
904494178 1:30877500-30877522 TGGGGCTTGCAGGGGAACACAGG + Intronic
905986833 1:42292678-42292700 TGGCAACTGCTGGGAATGACGGG + Intronic
906166006 1:43686666-43686688 TGGGACATGCAGGGAAAGATGGG - Intronic
906244184 1:44261774-44261796 TGGGAGTAGATGGGAAAGCCAGG - Intronic
906360727 1:45155871-45155893 GGGGACTTGGGGGGAAAGAGTGG + Intronic
906681420 1:47728234-47728256 TGGGAGTTGGTGGGAGAGAGGGG - Intergenic
907413606 1:54299230-54299252 TGGGACTTGCTGCAAGACACTGG + Intronic
908179302 1:61588405-61588427 TGGGAGTTAATGGGGAAGACAGG - Intergenic
908205411 1:61843061-61843083 TGGCACTCACTGGGAAAGCCTGG - Intronic
910762645 1:90749676-90749698 TGTGACTTGCTGGGAAAGCCTGG - Intergenic
910929076 1:92424506-92424528 TGGGAGTAGCTGAGAATGACTGG + Intergenic
911895740 1:103432850-103432872 AGGCACTTTCAGGGAAAGACAGG + Intergenic
913087620 1:115453458-115453480 TGGGAGTGGATAGGAAAGACAGG + Intergenic
915467281 1:156105026-156105048 GGGGTCTGGCTGGGAAGGACAGG - Intronic
915825516 1:159071884-159071906 TGGGACTAGCTTGGAAACTCAGG - Intronic
916246045 1:162689271-162689293 TGGCACTTTCTTGGAAACACAGG - Intronic
917318453 1:173753974-173753996 TGGGACATGCTGGGGAAAAATGG - Intronic
919598665 1:199595711-199595733 GGGGACTTGCGGGGAAAGGTGGG + Intergenic
920060689 1:203225096-203225118 TTGGGATTCCTGGGAAAGACAGG + Exonic
922168604 1:223136252-223136274 GAGGACTTGCTAGGCAAGACAGG + Intronic
923846200 1:237735501-237735523 TGAGACCTGCTGGAGAAGACAGG + Intronic
924209226 1:241747782-241747804 AAAGACTTCCTGGGAAAGACAGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063227216 10:4026940-4026962 TGGCCCTCGCTGGGAAAGACGGG + Intergenic
1067999100 10:51310868-51310890 TGGTTGGTGCTGGGAAAGACAGG + Intronic
1068861228 10:61850182-61850204 TGGGACTTGGAGGGGAAGCCAGG - Intergenic
1069624158 10:69857132-69857154 TAGGTCTTGCTGGTAGAGACTGG - Intronic
1069848551 10:71390280-71390302 TGGCACTTGGTGGCAAGGACTGG - Intergenic
1071358609 10:84822517-84822539 TGGGTCTTGGTGGGAAGGCCTGG + Intergenic
1071464049 10:85923450-85923472 AGGCACTGGCTGGGAAAGGCTGG + Intronic
1073622383 10:105062671-105062693 TAGCCCTTGCTGGGAAAGACAGG - Intronic
1073772881 10:106754603-106754625 TGGGACTTGTTGAAAAAGATGGG + Intronic
1074709812 10:116167934-116167956 GGGGACTTGGTGGGGAAGATTGG + Intronic
1075188678 10:120286242-120286264 TGGGCCTTTATGGGAAAGATGGG + Intergenic
1075227326 10:120641284-120641306 TGGGACAGGCTTGGAAAGAGGGG + Intergenic
1075388497 10:122075288-122075310 TGGGACTTGGTGGGGAAGGATGG - Intronic
1075398282 10:122143138-122143160 TGGGATTTGCGGGCAAAGCCTGG + Intronic
1075538068 10:123287795-123287817 TGGGACTTGGTGTCAGAGACAGG + Intergenic
1076818068 10:132924355-132924377 TGGGCCATGCTGGGTGAGACAGG - Intronic
1078136910 11:8659162-8659184 AGGGATGTGCTTGGAAAGACCGG + Intronic
1078413504 11:11147096-11147118 TGTGCCATGCTGGGAAAGCCTGG - Intergenic
1078853001 11:15180782-15180804 TGGGACTTGCTGGCAGGGAAGGG - Intronic
1079084071 11:17432870-17432892 TGGGACTTGGTGTGACAGAAGGG + Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080903443 11:36517093-36517115 TTGAACTTGGTGGGAAAAACAGG + Intronic
1082881047 11:58038635-58038657 TGGGACTTGGTGAGAATGACTGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083782523 11:64925659-64925681 TGGGAGGTGCTGGGTGAGACTGG - Exonic
1084337963 11:68472210-68472232 TGGGACGTGGTGGTAAAGCCGGG + Intronic
1088414870 11:109577765-109577787 GGGGACTTGGGGGGAAAGATGGG + Intergenic
1088420059 11:109635801-109635823 TGGGACCTGGAGGGAAAGCCTGG + Intergenic
1088504832 11:110517503-110517525 TGGGAATCTTTGGGAAAGACTGG - Intergenic
1089385668 11:118066019-118066041 TGGGCCCTGCTGGGGAAGAGGGG + Intergenic
1090426386 11:126609517-126609539 GGGGACCTGCTGGGAGAGAGGGG + Intronic
1091462494 12:655233-655255 TAGGACTTCCTAGCAAAGACTGG - Intronic
1091635091 12:2190960-2190982 TGGGACTTGCAGGAAATGACTGG - Intronic
1093428915 12:19061278-19061300 TGGGAAATGGGGGGAAAGACTGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1095192285 12:39271326-39271348 TGAGTCTTGCTGGGGAAGTCAGG - Intergenic
1098147753 12:67515379-67515401 TGGGAATTTCTGGGAGAGAAGGG - Intergenic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1099687135 12:85904800-85904822 GGGGACTTGGAGGGAAAGGCGGG - Intergenic
1101415009 12:104501276-104501298 TGGGAGTTCCTGGGAGGGACAGG + Intronic
1102741243 12:115209331-115209353 TGGGGCGTTCTGGGCAAGACTGG + Intergenic
1104048026 12:125177158-125177180 TCGGATTGGCTGGGAAAGCCAGG - Intergenic
1104610236 12:130221490-130221512 TGGGACTTGATGGGAATGGTGGG - Intergenic
1106876211 13:34076737-34076759 TGGGACGTGCTGAGAGAGACTGG - Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107820633 13:44282531-44282553 AGGGACTTGCTGGGTAGGAATGG - Intergenic
1108433242 13:50375902-50375924 TGGGTCTTGCTGAGAAAAAAGGG - Intronic
1111399587 13:87716780-87716802 TGGGATTTGCACGGAAATACTGG - Intergenic
1112724655 13:102289287-102289309 TGGGAAATGCTGGGAATGAATGG - Intronic
1112941797 13:104872305-104872327 TGGCACTTGCTAGGATAGAAGGG + Intergenic
1114455551 14:22851173-22851195 TGGGCCTGGCTGGGGAAGGCTGG - Intergenic
1114574240 14:23697884-23697906 TGTGCCTTGCTGGGCCAGACGGG - Intergenic
1116898071 14:50336475-50336497 TGGGTCTTGCTGGGACGGAGGGG - Intronic
1117756979 14:58985186-58985208 TTGGACTTGATGTGAAAGATGGG + Intergenic
1118679522 14:68225701-68225723 TGGGATTAGCTTGGAAAGAGAGG + Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1120783857 14:88512171-88512193 TGGGATTTGCTGTAAAACACTGG - Intronic
1120793519 14:88607459-88607481 TGGTACTTGCTGGGTGAGATGGG - Intronic
1120793582 14:88607756-88607778 TGGTACTTGCAGGGTAAGATGGG - Intronic
1121408101 14:93731394-93731416 TGTGACTTGGGGGAAAAGACAGG + Intronic
1122354911 14:101117039-101117061 TGGGACTTGTTGGGGGAGAGGGG + Intergenic
1122684205 14:103491931-103491953 TGGGACAGGCTGGGAGAGGCAGG - Exonic
1122972721 14:105158913-105158935 TGGGCCTTGCTGGGGAAGTGTGG - Intronic
1202901930 14_GL000194v1_random:49287-49309 TGGGGCTTGTGGAGAAAGACAGG + Intergenic
1124348271 15:28936831-28936853 GGGGCCCTGCTGGGACAGACAGG + Intronic
1124468133 15:29958766-29958788 GTGGAGTTGCTGGGAAAGAGGGG - Intronic
1124549902 15:30670265-30670287 TTGGCCCTGCTGGGAAAGAGTGG + Intronic
1125589765 15:40846865-40846887 TGGGACTTGGTGGCCCAGACTGG - Intronic
1125770877 15:42164990-42165012 TGGTACCTGCAGGGAAGGACAGG + Exonic
1126182062 15:45795033-45795055 TGGGACTTGGTGGGTCAGGCAGG - Intergenic
1128527132 15:68420247-68420269 TGGGACTTCCTAGGAAACAAGGG - Intronic
1128709823 15:69863519-69863541 TGGGAGCTGCTGGGAGACACGGG - Intergenic
1129152325 15:73696865-73696887 TGGGGCTGGCAGGGAAAGAGAGG + Intronic
1130103525 15:80912100-80912122 TGGGAGAGGCTGGGAGAGACTGG + Intronic
1130103527 15:80912110-80912132 TGGGAGAGACTGGGAAAGACTGG + Intronic
1131473113 15:92713528-92713550 GGGGACTTGCAGGGGAAGGCTGG + Intronic
1132061626 15:98697119-98697141 AGGGGCTTGCTGGGACAGGCTGG + Intronic
1132669689 16:1097511-1097533 TGGGGCTTGCAGAGAAAGACGGG + Intergenic
1132732924 16:1371729-1371751 TGGGAGTTGCTGGGGCAGCCAGG + Intronic
1132759087 16:1500285-1500307 TGGGCCTGGCGGGGACAGACTGG + Intronic
1133477959 16:6141565-6141587 TTGGACAAGCAGGGAAAGACAGG - Intronic
1133637126 16:7677801-7677823 TGGGGCATGCTGGGTCAGACAGG + Intronic
1133772975 16:8878409-8878431 GGGGACTTGCTGGGTCATACTGG - Intergenic
1135420958 16:22305214-22305236 TGGGACTTGAAGGTAAAGAGGGG + Intronic
1136579675 16:31143647-31143669 TGGGGCTGGGTGGGAAAGGCAGG + Exonic
1138449656 16:57086050-57086072 GGGGACTTGCGGGGGAAGAGTGG - Intergenic
1138485697 16:57341733-57341755 TGGGACTTGCTCGGAAATCCAGG + Intergenic
1141141538 16:81499802-81499824 TGCGAGTTGCTGGGCAGGACCGG - Intronic
1144611768 17:16725613-16725635 GGGGACTTGTGGGGAAAGAGTGG + Intronic
1144900971 17:18589773-18589795 GGGGACTTGTGGGGAAAGAGTGG - Intergenic
1144970773 17:19108181-19108203 AGGGACTTTGGGGGAAAGACTGG - Intergenic
1144991075 17:19234343-19234365 AGGGACTTTGGGGGAAAGACTGG - Intronic
1145057589 17:19713777-19713799 TGGGGCTTGCTGGGAAACCCGGG - Intronic
1145131535 17:20356294-20356316 GGGGACTTGTGGGGAAAGAGTGG + Intergenic
1145777303 17:27538426-27538448 GGGGACCTGCTGGGAAAGCATGG - Intronic
1146061371 17:29609146-29609168 TGGCACTGGCTGGGCAGGACCGG + Exonic
1147434114 17:40396409-40396431 TCGGACTTCCTGGGAAAGGGGGG - Exonic
1147475969 17:40711902-40711924 TGGGGCATGCTGGGAGAGAAAGG + Intergenic
1148345733 17:46902629-46902651 TGGGGGTTGCTGAGAAAGCCAGG + Intergenic
1148666721 17:49380471-49380493 TGTGTCTTGCTGGGACAGAATGG - Intronic
1151542861 17:74773680-74773702 TGGTACCTGCTGGGACAGAGGGG + Exonic
1152304932 17:79514885-79514907 TGGGACTTGGTGGGACAGGATGG + Intronic
1152642120 17:81453679-81453701 TGGGAACTGCTGGGCAGGACAGG + Intronic
1152777132 17:82209181-82209203 TGGCACTTGCTGGAGAAGAGGGG + Intronic
1156503707 18:37575898-37575920 TGCGACTTCCTAGGAGAGACGGG + Intergenic
1156816670 18:41319801-41319823 TGTGAGTTACTGGAAAAGACTGG - Intergenic
1160276663 18:77443602-77443624 GGGGACTTACGGGGAAAGAGTGG - Intergenic
1161520217 19:4719729-4719751 GGGGACGTGCTGGGGAAGCCAGG + Intronic
1161903095 19:7134335-7134357 TGGGAGTTGCAGGGAAAGGCAGG - Intronic
1162908838 19:13839065-13839087 TGGGGCCTGATGGGAAAGAGTGG - Intergenic
1163420591 19:17211808-17211830 TGGGGCCTGCTGGGATGGACGGG - Intronic
1164808044 19:31132641-31132663 TGTGACTTGCAGGCTAAGACTGG - Intergenic
1164953932 19:32364489-32364511 GGGGACTTGGGGGGAAAGAGTGG - Intronic
1166297051 19:41894575-41894597 TGGGAGCAGCTGGGGAAGACAGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167000892 19:46745580-46745602 TGGGACCCGCTGGGAAAGAGCGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168072775 19:53962143-53962165 TGGGGCTTGCAGGGGAAGAGTGG + Intergenic
926155307 2:10450219-10450241 TGGGCAGTGCTGGGAACGACTGG - Intergenic
927950544 2:27165502-27165524 GGGCACTTGATGGGAAGGACGGG - Intergenic
928610391 2:32986704-32986726 TGAGACTTGTTGAGAGAGACAGG - Intronic
928854681 2:35789749-35789771 TGGGAATTGCAGGGGAAGAGGGG - Intergenic
930207243 2:48600188-48600210 TGAGACTTCCTGGGGAAGAAAGG + Intronic
932085124 2:68750976-68750998 CTGGACTTGCTGGGAGAGAAAGG - Intronic
933860264 2:86459495-86459517 TGAGACTTGCTGAGGAAGAAGGG + Intronic
934490113 2:94756591-94756613 AGGGACCTGCAGGGAGAGACAGG + Intergenic
934504760 2:94881148-94881170 TGGGGCTTGTGGAGAAAGACGGG - Intergenic
935815068 2:106839644-106839666 TGGGACATGGAGGGAGAGACTGG - Intronic
938465515 2:131522324-131522346 AGGGACTTCTGGGGAAAGACTGG + Intergenic
940691533 2:156925696-156925718 TGGGGCTTGGTGGGAATGATTGG - Intergenic
941413011 2:165183915-165183937 TGTGAGTTGCTGTGAAGGACTGG + Intronic
941517136 2:166493884-166493906 TGGGAGTGGATGGGAAAGGCTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941735838 2:168976272-168976294 TAGCACTTGCATGGAAAGACAGG + Intronic
942789573 2:179744508-179744530 TGGGACTTGCCGAGACAGATTGG + Intronic
944207809 2:197175222-197175244 TGGGACTTCCTGAGAAAAGCCGG + Intronic
945135934 2:206627479-206627501 TGGGAGTATCAGGGAAAGACGGG + Intergenic
945868398 2:215201835-215201857 TGGAACATGCTGGAAAAGGCTGG + Intergenic
945989776 2:216385802-216385824 GGGGAATTGCTGGGAAGGACAGG - Intergenic
947816711 2:233042220-233042242 TGGGAGGTGCTGGGAGCGACAGG + Intergenic
947926352 2:233925657-233925679 TGGGATGTGGTGGGACAGACAGG + Intronic
948005143 2:234602267-234602289 TGGGACATGCATGGAAAGTCTGG + Intergenic
1170669003 20:18413013-18413035 TGGAAGTTGCTGAGAAAGACAGG - Intronic
1171879972 20:30611331-30611353 AGGGGCCTGCTGGGAGAGACAGG + Intergenic
1174534177 20:51237957-51237979 TTTGACTTGCTGGGAACGCCAGG + Intergenic
1175855117 20:62116942-62116964 TGGTACCTGCTGGAAAAGCCTGG + Intergenic
1176200717 20:63859073-63859095 TGGGACTTGTTTGGAAATGCAGG - Intergenic
1176621299 21:9064054-9064076 TGGGGCTTGTGGAGAAAGACAGG + Intergenic
1177584659 21:23074445-23074467 TGGGACTTGGAGGCAAAGACGGG + Intergenic
1177986472 21:27981311-27981333 TGTGCTTTGCTGGTAAAGACTGG - Intergenic
1178432476 21:32528759-32528781 GGGGACTTGCGGGGAAAGGCTGG + Intergenic
1178434947 21:32549956-32549978 AGGGACTTGATGGGAAACAAAGG - Intergenic
1179146528 21:38773313-38773335 TGGAAGTGGGTGGGAAAGACTGG - Intergenic
1179558042 21:42193223-42193245 TGGGCCATGCTGGGAAGGGCAGG - Intergenic
1180353045 22:11819485-11819507 TGAGAGTAGCTGGGACAGACAGG - Intergenic
1180385202 22:12172872-12172894 TGAGAGTAGCTGGGACAGACAGG + Intergenic
1181516132 22:23414817-23414839 TGGGCCCTGCTGGTACAGACCGG + Intergenic
1182968466 22:34547883-34547905 GGGGACTTGCAGGGAAAAGCTGG + Intergenic
1184608010 22:45585537-45585559 TGGGATTTGCCGTGAAAGCCAGG - Intronic
949806831 3:7964634-7964656 TGTGATTTGCTTAGAAAGACTGG - Intergenic
950641867 3:14353658-14353680 GGGGCCCTGCTGGGAAACACAGG - Intergenic
951710940 3:25584472-25584494 TGGCTCTTTCTGGGAAACACTGG - Intronic
952564284 3:34635777-34635799 AGGGACGTGCTGGGAAAGGAAGG - Intergenic
954368864 3:50159887-50159909 GGTGGCTTGCTGGGAAAGGCTGG + Intronic
955997236 3:64689049-64689071 TGAGAGATGCTTGGAAAGACTGG + Intergenic
956543925 3:70378059-70378081 GGGGAATTGCTGGGAAAGAAGGG - Intergenic
956640958 3:71414717-71414739 GGAGCCTTGCTGGGAAACACCGG + Intronic
957708000 3:83815086-83815108 TGGGCCTTTCTTGGAAAGATTGG - Intergenic
958482846 3:94666199-94666221 TGGGACTCTTTGGGAAGGACAGG - Intergenic
959108961 3:102098670-102098692 TGGTTATTGCTGGGAAAGGCAGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962860266 3:139392961-139392983 TGGGACTTACTGGGCCAGATAGG + Intergenic
966020784 3:175206545-175206567 GGGGACTTGGTGGGGAAGAGTGG + Intronic
966338500 3:178898619-178898641 TGTGACTTGAAGGGGAAGACAGG + Intergenic
967242897 3:187458482-187458504 AGGGAATTGCAGGGAAAAACAGG + Intergenic
968491162 4:891387-891409 TGGAACATCCTGGGACAGACAGG - Intronic
968793341 4:2684858-2684880 TGGGCCTTGCTAGGTAAGAGGGG - Intronic
969428359 4:7138842-7138864 TGGGACTTGCTGGGGCTGAGTGG + Intergenic
969536320 4:7758072-7758094 TTAGTCTTGCTGGGAAAGTCTGG - Intergenic
970535637 4:17027363-17027385 TGGGAATTCCTGGGGAAGGCAGG - Intergenic
973375818 4:49285963-49285985 GGGGAGTAGCTGGGACAGACAGG + Intergenic
973376718 4:49291982-49292004 GGGGAGTAGCTGGGACAGACAGG + Intergenic
973377636 4:49298134-49298156 CGGGAGTAGCTGGGACAGACAGG + Intergenic
973378556 4:49304270-49304292 CGGGAGTAGCTGGGACAGACAGG + Intergenic
973380503 4:49317233-49317255 GGGGAGTAGCTGGGACAGACAGG - Intergenic
973381592 4:49324278-49324300 GGGGAGTAGCTGGGACAGACAGG - Intergenic
973386112 4:49515350-49515372 GGGGAGTAGCTGGGACAGACAGG - Intergenic
974104094 4:57447986-57448008 AGGGAGTTGCTGGGTATGACCGG + Intergenic
977030198 4:91873726-91873748 GGGGACTTGCTGGGGAAGAGTGG - Intergenic
977608122 4:99003350-99003372 TGTAACTTGCTGGATAAGACAGG - Intronic
978501051 4:109410383-109410405 TGGGCCTTGCTGGGACAGATTGG + Intergenic
979207372 4:118054987-118055009 TGGGATTTACTGGGAAAGTCTGG + Intronic
979922868 4:126523904-126523926 TGAGAATAGCAGGGAAAGACTGG + Intergenic
982096803 4:151930783-151930805 TGTGACTTGCTGGCAATGCCTGG + Intergenic
982456408 4:155614407-155614429 TGGGATTTGCTTGGAAGGACAGG + Intergenic
982999672 4:162398351-162398373 GGGGACTTGCGGGGGAAGATTGG + Intergenic
983271007 4:165561643-165561665 AGGGACTTGAGGGGAAAGAGAGG - Intergenic
985433140 4:189900798-189900820 TGGAACATGGTGGGAAACACTGG - Intergenic
986892245 5:12322987-12323009 TGGGACTTCCAGAGAAAGAAAGG + Intergenic
987446526 5:18026415-18026437 GGGGACTTGCGGGGAAGGATGGG - Intergenic
989237634 5:39167410-39167432 TGGTAGTTTCTGGGAAAGAGAGG - Intronic
989575671 5:42985915-42985937 TGGGACTTGGTGGGAGATACAGG + Intergenic
990645678 5:57841541-57841563 TGGTAAGTGCTAGGAAAGACAGG + Intergenic
991244661 5:64497544-64497566 GGGGACTGCCTGAGAAAGACAGG - Intergenic
992481553 5:77156879-77156901 TGGGAGGTGCTGGGACAGGCTGG + Intergenic
993021088 5:82591772-82591794 TGGGGTTTGCAGGGAAAGAGGGG + Intergenic
994154655 5:96489640-96489662 GGGGTCATGCTGGGAAAGACAGG - Intergenic
994489665 5:100424882-100424904 TAGGACTTGTTAGGAAAAACAGG + Intergenic
995693313 5:114851774-114851796 GGGGACTTGCGGGGAAGGATGGG - Intergenic
998663488 5:144267728-144267750 TGTGACTTGCAGGGAAAGAATGG - Intronic
1001952174 5:175823984-175824006 TGGGGCTTGCTGGGGAGGAGAGG + Intronic
1003753743 6:9092675-9092697 TGAGCCTTGCTGTGAAAGACAGG - Intergenic
1004235773 6:13873533-13873555 TGGGACTTCGTGGGAGGGACGGG - Intergenic
1006627014 6:35404701-35404723 CTGGACTTGGTGGGAAGGACTGG + Intronic
1007071974 6:39044690-39044712 AGGGAATTGCTAGAAAAGACAGG - Intergenic
1007187206 6:39982040-39982062 TGGGTACAGCTGGGAAAGACTGG + Intergenic
1007352237 6:41282362-41282384 TGGGACTTGGGGGGAAAGAAGGG - Intronic
1007478809 6:42136722-42136744 TGGGACTTGCTGGGAAAGACTGG - Intronic
1008116124 6:47552299-47552321 GGGGACTTGGGGGGAAAGAATGG - Intronic
1009019611 6:57936853-57936875 AGGCACTTGCTGGCAATGACAGG - Intergenic
1011215471 6:85000882-85000904 TGGGACAGGCTGGAGAAGACAGG - Intergenic
1011442039 6:87397826-87397848 TGAGACTTGCTGAGAAGGGCTGG + Exonic
1013056873 6:106591376-106591398 TGGCACTGGCTGAGAAAGGCTGG + Intronic
1013516179 6:110888278-110888300 TGGGCCTTGCTGGGGGATACTGG + Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1017076897 6:150626980-150627002 TGGGACATGCTGGGAAAAAGGGG + Intronic
1017203781 6:151783377-151783399 TGGTACATGCAGGGCAAGACAGG + Intronic
1017616757 6:156254251-156254273 AGGGACTTGATGGGAAACAAAGG - Intergenic
1018852148 6:167648418-167648440 TGGGAGTTGGTGGGCAAGAAGGG + Intergenic
1019429379 7:991607-991629 GGGGGCTTGCTGGGAAATGCCGG + Intergenic
1021714643 7:23450700-23450722 GGGGGCTTACTGGTAAAGACCGG - Intronic
1024327297 7:48119153-48119175 GGGGACTTGCGGGGAAGGATTGG - Intergenic
1024483783 7:49893340-49893362 TGGGAGTCACTGAGAAAGACAGG + Intronic
1024544929 7:50509107-50509129 TGGTTCTTGGTGGGGAAGACAGG - Intronic
1024852308 7:53733956-53733978 TGGCATTTGGTGGGAAAGAAAGG - Intergenic
1026459545 7:70601591-70601613 TGTGACTTGCTAGGATAGAGTGG + Intronic
1027261763 7:76469789-76469811 TCTGTCTTGGTGGGAAAGACAGG + Intronic
1027313142 7:76967888-76967910 TCTGTCTTGGTGGGAAAGACAGG + Intergenic
1028512618 7:91641898-91641920 TGGGACATGGTGGGAGAGTCAGG - Intergenic
1029668830 7:102014461-102014483 TGGGACCTGCTGGATAAAACTGG + Intronic
1029686038 7:102148845-102148867 GGGGACTTGCGGGGAAAGGGTGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1032641922 7:133779543-133779565 TGGGACTTGCTGGGTCAGTGAGG + Intronic
1033358477 7:140620626-140620648 TGGGACTTGCTGGGCACCGCAGG - Intronic
1035396765 7:158540045-158540067 TGGGACTGGCTGGGACAGGCTGG + Intronic
1037687568 8:21156430-21156452 GGGGACTTGCAGGGAAAGGGAGG + Intergenic
1037898138 8:22671938-22671960 TGGGAAAGGCTGGGAGAGACAGG - Intergenic
1038909222 8:31943371-31943393 GGGGACTTGCAGGGAAAGTTTGG + Intronic
1039401150 8:37270420-37270442 TCGGGTGTGCTGGGAAAGACTGG + Intergenic
1040509960 8:48084773-48084795 GGGGAGTAGCTGGGAGAGACAGG + Intergenic
1042634972 8:70864344-70864366 GGGCACATGGTGGGAAAGACAGG - Intergenic
1042652782 8:71061404-71061426 TGGGAATTGATGGGTAAGGCTGG - Intergenic
1043508960 8:80931279-80931301 TGGGAACTCCTGGGAAAGGCTGG - Intergenic
1043683446 8:83060299-83060321 GTCGATTTGCTGGGAAAGACTGG - Intergenic
1046447380 8:114340646-114340668 TGGGAGTTGGTGGGTGAGACTGG + Intergenic
1046853597 8:119004011-119004033 TAGGACTTACTGGGAAAACCAGG + Intronic
1048605990 8:135969545-135969567 GAGGACTTTCTGGAAAAGACTGG + Intergenic
1048656347 8:136541346-136541368 GGGGACTTGGGGGGAAAGAGTGG + Intergenic
1049832784 8:144713043-144713065 TGGGACATCCTGGTGAAGACAGG - Intergenic
1049921287 9:366814-366836 TGGGACAGGCTGGGAAATGCAGG + Intronic
1050332002 9:4555125-4555147 TGGGCTTTGGTGGGACAGACTGG - Intronic
1052775341 9:32727430-32727452 AGGGACTTGCTGGGAGAAACTGG - Intergenic
1054703769 9:68441432-68441454 TGGGATTTACTGGGAAAGTGAGG + Intronic
1055284818 9:74717086-74717108 TGGGTTTTTCTGGGAAAAACTGG - Intergenic
1055658272 9:78474100-78474122 AAGGACTTGCTGGGAAATAATGG - Intergenic
1055688706 9:78806998-78807020 TGGGACTTAGTGGCTAAGACTGG + Intergenic
1056674608 9:88664577-88664599 TGGGATTTGTTGGGAAAGACTGG - Intergenic
1056758261 9:89396377-89396399 GGGGATGTGCTGGGAAGGACAGG - Intronic
1057201860 9:93144848-93144870 TTGTACAAGCTGGGAAAGACAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058705296 9:107632924-107632946 TGTGAGTTGTTGGGGAAGACTGG + Intergenic
1059815686 9:117910840-117910862 GGGGACTTGGAGGGAAAGAGTGG + Intergenic
1060026065 9:120172614-120172636 GGGGACTTGAGGGGAAAGAGTGG + Intergenic
1062114886 9:134802967-134802989 CGGGCCTTGCTGGAAAAGAAGGG + Exonic
1062670204 9:137704325-137704347 CGGGACTTGGAGGGAAGGACTGG + Intronic
1203699620 Un_GL000214v1:124635-124657 GGAGAGTAGCTGGGAAAGACAGG + Intergenic
1203699644 Un_GL000214v1:124782-124804 GGAGAGTTGCTGGGACAGACGGG + Intergenic
1203548733 Un_KI270743v1:151440-151462 GGGGAGTAGCTGGGACAGACAGG + Intergenic
1203549684 Un_KI270743v1:156965-156987 GGGGAGTAGCTGGGACAGACAGG - Intergenic
1203565601 Un_KI270744v1:84960-84982 TGGGGCTTGTGGAGAAAGACAGG - Intergenic
1187262661 X:17701608-17701630 TGTGAGTTACTGGGAAGGACTGG + Intronic
1189429137 X:40931807-40931829 TGGGGCATGCTGGGAAGTACTGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1195175886 X:102315046-102315068 TGGGACTTGAGGGGAAACCCAGG + Intronic
1195182978 X:102372047-102372069 TGGGACTTGAGGGGAAACCCAGG - Intronic
1195686546 X:107592089-107592111 GGGGACTTGCGGGGAAGGGCGGG - Intronic
1195967965 X:110446184-110446206 TGGGACTTGCGGGGAATGGGGGG + Intronic
1196172026 X:112599302-112599324 GGGGACTTGCGGGGGAAGAATGG + Intergenic
1199821221 X:151449078-151449100 GGGGACTTGGGGGGAAAGAGTGG - Intergenic
1200914802 Y:8562184-8562206 AGGGGCTCTCTGGGAAAGACAGG - Intergenic
1200915359 Y:8566678-8566700 AGGGGCTCTCTGGGAAAGACAGG - Intergenic
1200927086 Y:8664343-8664365 AGAGACTTCCTGGGAAAGACAGG - Intergenic
1200930433 Y:8691981-8692003 AGGGGCTTTCTGGGAAAAACAGG + Intergenic
1201157837 Y:11149508-11149530 TGGGGCTTGTGGAGAAAGACAGG + Intergenic