ID: 1007486147

View in Genome Browser
Species Human (GRCh38)
Location 6:42182077-42182099
Sequence ACATACATTCAGAAGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007486139_1007486147 29 Left 1007486139 6:42182025-42182047 CCAGCCTGGGTGACAGAGCCAGA 0: 1990
1: 51987
2: 138461
3: 166166
4: 155611
Right 1007486147 6:42182077-42182099 ACATACATTCAGAAGTGGGAGGG No data
1007486143_1007486147 -2 Left 1007486143 6:42182056-42182078 CCAATAAATAAATAAATACATAC No data
Right 1007486147 6:42182077-42182099 ACATACATTCAGAAGTGGGAGGG No data
1007486140_1007486147 25 Left 1007486140 6:42182029-42182051 CCTGGGTGACAGAGCCAGATCCT 0: 77
1: 1393
2: 11620
3: 49350
4: 117485
Right 1007486147 6:42182077-42182099 ACATACATTCAGAAGTGGGAGGG No data
1007486142_1007486147 5 Left 1007486142 6:42182049-42182071 CCTGTCTCCAATAAATAAATAAA 0: 10
1: 457
2: 1105
3: 4240
4: 48789
Right 1007486147 6:42182077-42182099 ACATACATTCAGAAGTGGGAGGG No data
1007486141_1007486147 11 Left 1007486141 6:42182043-42182065 CCAGATCCTGTCTCCAATAAATA No data
Right 1007486147 6:42182077-42182099 ACATACATTCAGAAGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007486147 Original CRISPR ACATACATTCAGAAGTGGGA GGG Intergenic
No off target data available for this crispr