ID: 1007488523

View in Genome Browser
Species Human (GRCh38)
Location 6:42199409-42199431
Sequence ATGTATCTTCAGAAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007488515_1007488523 5 Left 1007488515 6:42199381-42199403 CCCCTTACAACAAAGCCCCTTGT No data
Right 1007488523 6:42199409-42199431 ATGTATCTTCAGAAAATGGCAGG No data
1007488513_1007488523 29 Left 1007488513 6:42199357-42199379 CCAGCTATTGTCCTAAATTTTGC No data
Right 1007488523 6:42199409-42199431 ATGTATCTTCAGAAAATGGCAGG No data
1007488514_1007488523 18 Left 1007488514 6:42199368-42199390 CCTAAATTTTGCTCCCCTTACAA No data
Right 1007488523 6:42199409-42199431 ATGTATCTTCAGAAAATGGCAGG No data
1007488519_1007488523 -10 Left 1007488519 6:42199396-42199418 CCCCTTGTGGCAGATGTATCTTC No data
Right 1007488523 6:42199409-42199431 ATGTATCTTCAGAAAATGGCAGG No data
1007488517_1007488523 3 Left 1007488517 6:42199383-42199405 CCTTACAACAAAGCCCCTTGTGG No data
Right 1007488523 6:42199409-42199431 ATGTATCTTCAGAAAATGGCAGG No data
1007488516_1007488523 4 Left 1007488516 6:42199382-42199404 CCCTTACAACAAAGCCCCTTGTG No data
Right 1007488523 6:42199409-42199431 ATGTATCTTCAGAAAATGGCAGG No data
1007488512_1007488523 30 Left 1007488512 6:42199356-42199378 CCCAGCTATTGTCCTAAATTTTG No data
Right 1007488523 6:42199409-42199431 ATGTATCTTCAGAAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007488523 Original CRISPR ATGTATCTTCAGAAAATGGC AGG Intergenic
No off target data available for this crispr