ID: 1007490094

View in Genome Browser
Species Human (GRCh38)
Location 6:42214080-42214102
Sequence CTTGGTATAAGGAGCTACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007490094_1007490102 18 Left 1007490094 6:42214080-42214102 CCAAGGTAGCTCCTTATACCAAG 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1007490102 6:42214121-42214143 ACAGGTTTGGTCAAATCCTTTGG 0: 1
1: 1
2: 0
3: 6
4: 106
1007490094_1007490100 5 Left 1007490094 6:42214080-42214102 CCAAGGTAGCTCCTTATACCAAG 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1007490100 6:42214108-42214130 GGGAGTACATACCACAGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 108
1007490094_1007490099 0 Left 1007490094 6:42214080-42214102 CCAAGGTAGCTCCTTATACCAAG 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1007490099 6:42214103-42214125 AAACAGGGAGTACATACCACAGG 0: 1
1: 0
2: 0
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007490094 Original CRISPR CTTGGTATAAGGAGCTACCT TGG (reversed) Intronic
909072957 1:71018065-71018087 CTTGCTGTAAAGAACTACCTGGG - Intronic
910377766 1:86592481-86592503 ATTGCTATAAAGAGATACCTGGG + Intergenic
911234642 1:95398890-95398912 GTTGGTAGAAGGAGCTTCCTAGG - Intergenic
918542348 1:185645984-185646006 CAGGGTATAATGAGCTATCTTGG + Intergenic
918563420 1:185897104-185897126 CTTGGTTTAAATTGCTACCTAGG + Intronic
919539278 1:198828571-198828593 CTTGATGTCAGGAGCTGCCTGGG + Intergenic
922647338 1:227302284-227302306 CTTAGGATAAGGAGCTTCCCAGG - Intronic
1065240256 10:23696407-23696429 CTTGGTATCAGAAGCTAAGTGGG - Intronic
1065490020 10:26273421-26273443 ATGGGTGTAAGGAGCCACCTTGG - Intronic
1066278939 10:33896190-33896212 TTTGGTATAAAGAAATACCTGGG - Intergenic
1072263678 10:93706601-93706623 ATTGCTATAAAGAACTACCTGGG - Intergenic
1073703509 10:105956754-105956776 GTTGGTATCAGGAGCTAACTTGG + Intergenic
1091182400 11:133618693-133618715 TTTGGTAAATGGAGCTTCCTAGG + Intergenic
1101278348 12:103225900-103225922 GTTGGTCTAAGGGGCTTCCTAGG + Intergenic
1104487319 12:129162848-129162870 CTTGCTATAAAGAAATACCTGGG - Intronic
1109285688 13:60405664-60405686 GATGGAATTAGGAGCTACCTAGG + Intronic
1110076771 13:71255576-71255598 CTTGGGATTAGTGGCTACCTAGG - Intergenic
1111715087 13:91869667-91869689 ATTGCTATAAAGAGCTACCTGGG + Intronic
1112547670 13:100387541-100387563 CTTGGGATAAGGAGTCACATTGG - Intronic
1117457365 14:55911921-55911943 CTTGGTATAATGTGCTCCCTAGG + Intergenic
1119225240 14:72940208-72940230 TTTTGTCTAAAGAGCTACCTGGG + Exonic
1126339297 15:47621819-47621841 GTTGTTATAAAGAGCTACCAAGG + Intronic
1134640708 16:15827432-15827454 CTTGGTATAAGCGGCTCCATCGG + Intronic
1137815579 16:51394888-51394910 CAAGGAATAAGGAGCTGCCTGGG - Intergenic
1138098508 16:54232622-54232644 CTTGGCATAAGTAACTTCCTGGG - Intergenic
1140973910 16:80041059-80041081 CTTGGTACAAGCAGGGACCTGGG + Intergenic
1144642595 17:16945808-16945830 CTTGGTGGAAGGAGCAAGCTGGG - Intronic
1149775203 17:59351798-59351820 CTTTGCATGAGGAGCTTCCTTGG + Intronic
1159777702 18:72622935-72622957 ATTGCTATAAAGAACTACCTGGG + Intronic
1161366099 19:3880701-3880723 CTGGGAAGAAGCAGCTACCTCGG + Exonic
1166759226 19:45214007-45214029 CTTGAGATTAGGAGGTACCTAGG - Intronic
1168289058 19:55348106-55348128 CTTGTTATAAGCAGCACCCTTGG + Exonic
925871386 2:8274328-8274350 CTTGGAATAAGGAACTATCCAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
932985132 2:76716801-76716823 GTTTGTATAATGAGCTGCCTTGG - Intergenic
941875707 2:170430668-170430690 TATGGTATAAGAAGCTATCTAGG - Intronic
945283463 2:208059513-208059535 CTGGGAATAAAGAGCTGCCTAGG + Intergenic
946032363 2:216715396-216715418 CTGGGAAGAAGGAGCTAGCTGGG + Intergenic
1177287497 21:19071335-19071357 ATTGCTATAAAGAACTACCTGGG - Intergenic
1181688785 22:24546729-24546751 CTTGGTTTATGGAGCTCACTGGG - Intronic
1182922910 22:34096758-34096780 CTTGGTGTCAGGCCCTACCTTGG - Intergenic
1183060301 22:35332518-35332540 CTTGTTTTATGGAGCTACTTAGG - Intronic
951470137 3:23046808-23046830 ATTGCTATAAGGAAATACCTGGG - Intergenic
965167221 3:165210391-165210413 CTTCATATATGGAGCTAGCTTGG + Intergenic
965320870 3:167250111-167250133 CCTGATGTCAGGAGCTACCTGGG - Intronic
973238424 4:47931186-47931208 CTTGGTCCAATGAGCTACTTGGG - Intronic
976315616 4:83655792-83655814 CTGGGCATAAGGGACTACCTTGG + Intergenic
976945066 4:90755077-90755099 CTTCATATAAGGAGCTACTCTGG + Intronic
977451706 4:97207131-97207153 CTTTGAATCAGGAGCTGCCTGGG + Intronic
977565782 4:98579018-98579040 CTTGGTATTAGTAACTACATGGG - Intronic
977611448 4:99037478-99037500 CTTGGCATAAGGAGTTAAATAGG + Intronic
982516047 4:156351211-156351233 CTTGGTATAAGAATCTTACTAGG + Intergenic
987027580 5:13942838-13942860 TTAGGTATAAGGACCTATCTGGG - Intronic
987127827 5:14831294-14831316 GTTTGTATGAGGAGCTACTTAGG + Intronic
990111996 5:52337833-52337855 CTTGGTATAAGTAATTACATGGG + Intergenic
991062339 5:62390774-62390796 AGCGGTATAAGGTGCTACCTGGG - Intronic
994243524 5:97451499-97451521 CCTGGAATAAGGGGCTTCCTGGG + Intergenic
996914241 5:128693437-128693459 ATTGCTATAAGGAACTATCTGGG + Intronic
1000004613 5:157171572-157171594 ACTGGTAGTAGGAGCTACCTTGG + Intronic
1003053653 6:2801015-2801037 CTTTGTGGAAGGGGCTACCTGGG - Intergenic
1007490094 6:42214080-42214102 CTTGGTATAAGGAGCTACCTTGG - Intronic
1011228802 6:85137147-85137169 CTTGGTATAAAATGCTACCAGGG - Intergenic
1012382611 6:98638225-98638247 CTTGGTATAAGGTGCTTACTAGG + Intergenic
1018325798 6:162666780-162666802 CTTGGTACTATGAGCTACCTTGG + Intronic
1020729996 7:11868642-11868664 ACTGCTATAAAGAGCTACCTGGG - Intergenic
1020842901 7:13243124-13243146 ATTGATATAAGAAGCTTCCTAGG - Intergenic
1023218507 7:37893213-37893235 CCTGGTAAAACGAGCCACCTTGG - Intronic
1024846366 7:53648075-53648097 ATTGCTATAAGGGACTACCTAGG + Intergenic
1030327131 7:108232144-108232166 ATTGGACTAAGGAGCTTCCTAGG + Intronic
1032367029 7:131308883-131308905 ATTGCTATAAGGAACTACCTAGG - Intronic
1037452831 8:19034265-19034287 CTTGCTATAATGTGATACCTGGG - Intronic
1037596257 8:20356949-20356971 ATTGGTATAAAGAACTACCTGGG + Intergenic
1038520513 8:28228266-28228288 CTTTATATCAGGAGATACCTGGG + Intergenic
1048297736 8:133227073-133227095 CTTGGATGAAGGAGCTACATAGG + Intronic
1048369471 8:133765071-133765093 ATGGGTATAAGGAACTTCCTAGG + Intergenic
1049569915 8:143364540-143364562 CATGGTAGAAGGAGCCACATGGG - Intergenic
1057982949 9:99680836-99680858 ATTGCTATAAGGAACAACCTGGG + Intergenic
1193470074 X:81889926-81889948 ATTGCTATAAAGAACTACCTGGG - Intergenic
1193473318 X:81933449-81933471 GTTGCTATAAGGAAATACCTAGG - Intergenic
1196179816 X:112677584-112677606 CTTGATATAAGGAGTCACATCGG - Intronic
1196520841 X:116668832-116668854 CTTGATGTCAGGAGCTGCCTGGG - Intergenic
1198090996 X:133329740-133329762 CTTGGTATAAGGATTGAGCTAGG + Intronic
1201241630 Y:11962405-11962427 CTTGAGGTAAGGAGTTACCTTGG - Intergenic