ID: 1007492061

View in Genome Browser
Species Human (GRCh38)
Location 6:42230830-42230852
Sequence GGGCTTAATCAGACGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007492057_1007492061 7 Left 1007492057 6:42230800-42230822 CCAGTTCACTTTGGTGGGTGCCA 0: 1
1: 0
2: 1
3: 11
4: 83
Right 1007492061 6:42230830-42230852 GGGCTTAATCAGACGCAGCATGG 0: 1
1: 0
2: 0
3: 2
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007492061 Original CRISPR GGGCTTAATCAGACGCAGCA TGG Intronic
906298286 1:44662502-44662524 GGGCAGAGTCAGACCCAGCAAGG - Intronic
907298640 1:53471388-53471410 GGGCAAATTCAGGCGCAGCATGG + Intergenic
915548527 1:156618004-156618026 GGACTTAATTAGGCCCAGCATGG + Intergenic
915909110 1:159901284-159901306 AGGCTTAATCAGAGGGAGAAGGG + Intergenic
917978449 1:180254810-180254832 GGACTGAGTCAGAAGCAGCAAGG + Intronic
919106900 1:193164735-193164757 GGGATTAGTCAGACACAACAAGG - Intronic
921812863 1:219534274-219534296 GCGGTTACTCAGACACAGCATGG + Intergenic
1063586724 10:7358943-7358965 AGACTTAATAAGAAGCAGCAGGG + Intronic
1078530065 11:12130375-12130397 GGGCTGAATCAGAGGCCACAGGG + Intronic
1078671460 11:13369456-13369478 AGGCTTTAACAGATGCAGCATGG - Intronic
1079353354 11:19712124-19712146 GGGCTCCATGAAACGCAGCAAGG + Intronic
1084501560 11:69538503-69538525 GGACTTAATCAGACACAGTTGGG - Intergenic
1088133709 11:106527797-106527819 AGTCTTCATCAGACACAGCATGG - Intergenic
1090242454 11:125193758-125193780 GGGCTGGATGAGAGGCAGCACGG + Intronic
1093795374 12:23304002-23304024 GAAGTTTATCAGACGCAGCAGGG + Intergenic
1096084787 12:48858122-48858144 AGGCTTGTTCAGACACAGCATGG + Exonic
1096552279 12:52380865-52380887 GGGCTAGAGCAGACCCAGCAGGG - Intronic
1099078088 12:78137337-78137359 GGGCTCATTCAGAGACAGCATGG + Exonic
1099264349 12:80425975-80425997 GGTCTTTATGAGAGGCAGCAGGG - Intronic
1107567756 13:41623474-41623496 GGGATGAATGAGAGGCAGCAGGG + Intronic
1113362805 13:109646611-109646633 GGGCCTAATGCGACGCACCACGG - Intergenic
1120124599 14:80726155-80726177 TGGCTAAATCAGACACATCATGG - Intronic
1121236545 14:92395365-92395387 GGGCTTAATCAGAAGCCTTAAGG + Intronic
1131455482 15:92579734-92579756 TGGCTCAGCCAGACGCAGCAAGG + Intergenic
1131857995 15:96619243-96619265 GTTCTTAATCAGAAGCAGAAGGG + Intergenic
1132894228 16:2220314-2220336 GGGCTTAAGCAGAAGCAGGAAGG - Intergenic
1133182923 16:4072299-4072321 GGGGTTAATCAGAAGCCACATGG - Intronic
1140021790 16:71246098-71246120 GGGGTTAACCAGAGGCAGTATGG + Intergenic
1143597271 17:7922867-7922889 GGGCCTAGAAAGACGCAGCAGGG + Exonic
1145025603 17:19465854-19465876 GGGGTTAATGAGACTCAGAAGGG - Intergenic
1152815230 17:82404012-82404034 GGGCTTGGTCAGATGCAGCGAGG + Exonic
1155073995 18:22339373-22339395 GGGGTTGGTCAGACTCAGCATGG - Intergenic
1157480058 18:48048085-48048107 GGGTTTAATCAGAGCCAGCCTGG + Intronic
1157588577 18:48820757-48820779 GGTTTTACTCAGAAGCAGCAAGG - Intronic
1162409567 19:10497284-10497306 GGGGTTGATCAGACGCCCCAGGG - Intronic
1168402168 19:56091786-56091808 GGCCTTACTGAGATGCAGCACGG - Intronic
930309236 2:49716612-49716634 GGGCTTAATAAGAAACAGCAAGG - Intergenic
937990094 2:127657364-127657386 GGGCTTTCTCAGACCCAGCTCGG - Intronic
941754972 2:169175205-169175227 GGTCTTCATCAGACCCATCAGGG + Exonic
948578471 2:238969024-238969046 GGGCTTAAACAAACCCATCAGGG - Intergenic
1180342764 22:11630784-11630806 GGGCTTAATTTGACTCAACATGG + Intergenic
951190315 3:19761364-19761386 GTGCTTCATCAGATCCAGCAAGG - Intergenic
953182510 3:40609318-40609340 GAGCTTAATCACAGGAAGCATGG + Intergenic
970530702 4:16979659-16979681 GGTCTAAATCAAACGAAGCATGG + Intergenic
971270780 4:25142646-25142668 GGGCTTATTCAGATGCAGGGAGG + Intronic
980601025 4:135024921-135024943 GGGATTAATCAGATGAAGAAGGG - Intergenic
988642673 5:33058644-33058666 TGGCTAAATCAGAAGGAGCAAGG + Intergenic
990118121 5:52414293-52414315 GAGCTTACTCAGCCACAGCAGGG - Intergenic
990894734 5:60686502-60686524 GGGCTTAATCTGAGACATCAGGG + Intronic
992465193 5:76997398-76997420 TCGCTTATTCAGACGCATCATGG - Intergenic
1000345099 5:160307775-160307797 GGGCTTCTGCAGATGCAGCAGGG + Intronic
1000381715 5:160635403-160635425 GGGCTTCATCAGCCACAGTAAGG + Intronic
1007492061 6:42230830-42230852 GGGCTTAATCAGACGCAGCATGG + Intronic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1020617660 7:10479378-10479400 GAGCTTATTCAGGCACAGCAAGG - Intergenic
1021315579 7:19144358-19144380 GGTCTGAAGCAGACGCCGCAAGG - Intergenic
1027798517 7:82723116-82723138 TTGCTTAATCAAAGGCAGCAAGG - Intergenic
1036784826 8:11679405-11679427 GGGCTTTATCAGACCCGGCTGGG - Intronic
1044852401 8:96441919-96441941 AGGCTTAAGCAGGAGCAGCATGG + Intergenic
1046300491 8:112279732-112279754 GGTCTTAATCAGGGGCATCAGGG - Intronic
1047403280 8:124563527-124563549 GGGCTTGACCAGACTCAGCTAGG - Intronic
1062621166 9:137423189-137423211 GGGCTTTATCCGGCGCACCAAGG + Exonic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1189605815 X:42676579-42676601 GGGCTTAATGAGGAGAAGCAAGG + Intergenic