ID: 1007492345

View in Genome Browser
Species Human (GRCh38)
Location 6:42233214-42233236
Sequence TAAAGTATACAGAAGGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 674
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 616}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007492345_1007492350 4 Left 1007492345 6:42233214-42233236 CCATTTCCCTTCTGTATACTTTA 0: 1
1: 0
2: 3
3: 54
4: 616
Right 1007492350 6:42233241-42233263 TTTCCATCTGAGGAATGAGAGGG No data
1007492345_1007492349 3 Left 1007492345 6:42233214-42233236 CCATTTCCCTTCTGTATACTTTA 0: 1
1: 0
2: 3
3: 54
4: 616
Right 1007492349 6:42233240-42233262 TTTTCCATCTGAGGAATGAGAGG 0: 1
1: 0
2: 4
3: 44
4: 499
1007492345_1007492348 -6 Left 1007492345 6:42233214-42233236 CCATTTCCCTTCTGTATACTTTA 0: 1
1: 0
2: 3
3: 54
4: 616
Right 1007492348 6:42233231-42233253 ACTTTATTTTTTTCCATCTGAGG 0: 1
1: 0
2: 6
3: 91
4: 790
1007492345_1007492352 8 Left 1007492345 6:42233214-42233236 CCATTTCCCTTCTGTATACTTTA 0: 1
1: 0
2: 3
3: 54
4: 616
Right 1007492352 6:42233245-42233267 CATCTGAGGAATGAGAGGGCTGG 0: 1
1: 0
2: 6
3: 59
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007492345 Original CRISPR TAAAGTATACAGAAGGGAAA TGG (reversed) Intronic
901106104 1:6757918-6757940 TAAACTATGCAAGAGGGAAAAGG - Intergenic
901603427 1:10440441-10440463 TAATGTATTCCGATGGGAAAGGG - Intronic
902319376 1:15649749-15649771 TCAAGTATAGAGAAGGAACATGG - Exonic
902850195 1:19149320-19149342 AAAAGTATTCAGAAGGTAACTGG + Intronic
902894145 1:19467341-19467363 TAAAGCAAACAGAAGGGAGAAGG + Intronic
903566259 1:24267988-24268010 TAAAGTATACTGGAGGGGACTGG - Intergenic
903566297 1:24268292-24268314 TAAAGTATACAGGAGGGGGCTGG - Intergenic
903600381 1:24534042-24534064 GAAAGTAAAGAGAAGGAAAAAGG - Intronic
903704568 1:25275890-25275912 TCAAGTGAACAAAAGGGAAAAGG - Intronic
904100601 1:28023383-28023405 TAAAGAATACAGTACAGAAAGGG + Intronic
904217498 1:28934363-28934385 TAAAGAGTACAGTATGGAAAAGG - Intronic
905622060 1:39456924-39456946 TAAAGGACACAGAAGTCAAAAGG - Intronic
906369957 1:45245088-45245110 AAAAGGATAAAGCAGGGAAAGGG + Intronic
906920826 1:50062670-50062692 TAGAATACACAGGAGGGAAAAGG + Intronic
907133616 1:52118952-52118974 TAAAGTTCAGAGAAGGGGAAAGG - Intergenic
907161403 1:52372877-52372899 CAAAGTATATTGAATGGAAATGG - Exonic
907951436 1:59187586-59187608 TAAAAGACACTGAAGGGAAAAGG + Intergenic
908056377 1:60291514-60291536 TCAAGCAGACAGAAGTGAAAAGG - Intergenic
908842839 1:68295990-68296012 TAAATGATGCAGAAGGGATAAGG - Intergenic
909494929 1:76267911-76267933 TGCAGTATAGAGAAGAGAAAAGG + Intronic
910254793 1:85237222-85237244 TAATGAAAACAGAAGGGGAAAGG + Intergenic
910419881 1:87047391-87047413 TAAAAGATACAGAAATGAAAAGG - Intronic
910437708 1:87221852-87221874 TACAGTATACACATAGGAAATGG + Intergenic
910811358 1:91240402-91240424 TAAAGTTTAAAGAAAGGAAAGGG - Intergenic
911255329 1:95626807-95626829 TAAAATATACAGCAGGAAACAGG - Intergenic
911330768 1:96523333-96523355 TAAAAAATAAAAAAGGGAAAAGG - Intergenic
911460498 1:98183024-98183046 TACAGTATACTGAAGGGTGAGGG - Intergenic
911620898 1:100065630-100065652 AAAAGAAAAAAGAAGGGAAAGGG - Intronic
911803693 1:102177754-102177776 TAAAGCATATACAATGGAAAGGG - Intergenic
911899106 1:103478270-103478292 TCAACAATACAGAAGGGAGATGG + Intergenic
912782423 1:112564205-112564227 TGACTTATACTGAAGGGAAAAGG + Intronic
913978398 1:143485403-143485425 TAAAGTAAATAGAAGAAAAAAGG - Intergenic
914072808 1:144311051-144311073 TAAAGTAAATAGAAGAAAAAAGG - Intergenic
914106346 1:144655309-144655331 TAAAGTAAATAGAAGAAAAAAGG + Intergenic
914998829 1:152568621-152568643 AACAGTATACAGAAGGGGGAGGG - Intronic
915778598 1:158520184-158520206 TAGAGTATAGAGAAGACAAAGGG + Intergenic
916908311 1:169314838-169314860 TAAAGTAAAAAGAATGGAAAAGG + Intronic
917083652 1:171283400-171283422 TTAAGAAGAGAGAAGGGAAAGGG + Intronic
917715772 1:177735547-177735569 TAAAAAATACAGAAGAGAAGAGG + Intergenic
917946833 1:179982266-179982288 TAAAGTATAAAATAGGCAAAAGG - Intronic
918489829 1:185069602-185069624 TAAAGTATACAGAATCTACATGG - Intronic
918976759 1:191498310-191498332 TTAAGCATAAAGAAGGGGAAGGG - Intergenic
919341052 1:196307296-196307318 AAAAGTAAACAGAAAAGAAATGG - Intronic
919367315 1:196679008-196679030 TAAGCTATACACAAGGAAAATGG + Intronic
919415150 1:197298737-197298759 AAAATTATACATAAGAGAAATGG + Intronic
919724791 1:200874448-200874470 CCAAGTAGACAGAAGGGAAGTGG + Intergenic
920235816 1:204503902-204503924 TAAATTTTAGGGAAGGGAAATGG - Intergenic
921143867 1:212332871-212332893 TAAAAAAGAAAGAAGGGAAAGGG - Intronic
921367741 1:214389777-214389799 TATACTCTAAAGAAGGGAAAAGG + Intronic
921814613 1:219549564-219549586 TGGAGAACACAGAAGGGAAAAGG - Intergenic
921913266 1:220576093-220576115 AAAAGTAAACACAAGAGAAAAGG - Intronic
922006593 1:221537133-221537155 TGCAGTATAAAGAAGGCAAAGGG + Intergenic
922652650 1:227354551-227354573 AAAAGGATACAGAGGAGAAAAGG - Intergenic
922658075 1:227403008-227403030 TAAAGTAAAGAGATGGAAAAAGG + Intergenic
923208526 1:231781418-231781440 TAAATTATATAAAAGAGAAATGG - Intronic
923303748 1:232668901-232668923 TAAACTATATAGAAGTTAAAAGG + Intergenic
924201381 1:241662871-241662893 CAATGCAAACAGAAGGGAAAAGG + Intronic
924262987 1:242251263-242251285 TAAAGTGAAGAGAAGGGAAGAGG + Intronic
924478674 1:244406093-244406115 GAAAGAATACATAAGAGAAATGG - Intergenic
1063114199 10:3062334-3062356 CAAAGTATAGAGAAAGAAAAAGG - Intergenic
1063252267 10:4286647-4286669 AAAAGTAGAGAGAAAGGAAATGG + Intergenic
1063444349 10:6100090-6100112 GAAAGTTTACAGAACGGAAGGGG - Intronic
1063653812 10:7966859-7966881 TAAAATATAAAAAAGTGAAATGG + Intronic
1064712789 10:18143435-18143457 TAAAGGAGAGAGAAGAGAAAGGG + Intronic
1065524251 10:26602469-26602491 TAAATTATCCAGAATAGAAAAGG + Intergenic
1065532063 10:26681080-26681102 TAAATTATCCAGAATAGAAAAGG + Intergenic
1065713927 10:28545555-28545577 GAGAGTACACAGAAGGGAAGAGG + Intronic
1066146841 10:32568327-32568349 TGACATATACAGAAGGTAAAGGG - Intronic
1067035049 10:42908777-42908799 TAAAGTATGTGGAAGGAAAAGGG - Intergenic
1068326989 10:55503976-55503998 AAAACTATACAGAATGTAAAAGG + Intronic
1068484726 10:57643293-57643315 TAATGGATAGACAAGGGAAAAGG + Intergenic
1068909737 10:62366739-62366761 TAAACTATCAAGAAAGGAAAGGG + Intergenic
1069412472 10:68167845-68167867 TAAAGTAAAAAGAGGGGAAGAGG + Intronic
1069675825 10:70246673-70246695 TAGAGTACACTAAAGGGAAAGGG - Intergenic
1069915738 10:71785575-71785597 CAAAGTAGAAAGCAGGGAAAAGG + Intronic
1070266645 10:74909404-74909426 TAAAATAGATATAAGGGAAAAGG - Intronic
1070552610 10:77502490-77502512 TAGAGTATCCAGGATGGAAAAGG - Intronic
1070992460 10:80744483-80744505 AAGAGAACACAGAAGGGAAATGG + Intergenic
1071029928 10:81165344-81165366 TAAAATATATGGAAGTGAAAAGG - Intergenic
1071916765 10:90301737-90301759 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
1071948552 10:90676498-90676520 TAATGGAAACAGAAGGGAGAAGG - Intergenic
1071975301 10:90949313-90949335 TAAAGTATAATGAAAAGAAAAGG - Intergenic
1072101248 10:92231492-92231514 GAGAGTGGACAGAAGGGAAAAGG - Intronic
1073223894 10:101900041-101900063 AAAAGTAGACATAAGGGGAATGG - Intronic
1073673291 10:105616473-105616495 AAATGTATGCAGGAGGGAAAGGG - Intergenic
1074180745 10:111060377-111060399 AGAAGTATAGAGAAGGAAAAGGG - Intergenic
1074495540 10:113977191-113977213 TGAAGAATGCAGATGGGAAATGG - Intergenic
1074693164 10:116025360-116025382 GAAAGCATAGAGAAGGGGAAGGG + Intergenic
1074799230 10:116982325-116982347 TAAGGTATAAGGAAAGGAAAGGG + Intronic
1075257346 10:120935768-120935790 AAAAGAAGACAGAAGGGAAAAGG - Intergenic
1075794147 10:125106928-125106950 TAAAGCAAAAAGAAGGGGAATGG + Intronic
1075986852 10:126795585-126795607 TAAAGAGCACAGTAGGGAAAGGG + Intergenic
1077447917 11:2609252-2609274 GAAAGAATTCACAAGGGAAATGG - Intronic
1077716046 11:4581649-4581671 TAGAGTATCCAGAGGGAAAAGGG + Intergenic
1078875698 11:15393927-15393949 TAAAGTATCCAGAATGGAAGAGG - Intergenic
1078969190 11:16386966-16386988 AAAATTATACAAAAGGTAAAAGG + Intronic
1080083620 11:28252235-28252257 GAAAATATAAAGAAGGGAAAGGG + Intronic
1080806076 11:35655305-35655327 GAAAATATTCAGAAGGGAATTGG + Intergenic
1081354863 11:42100145-42100167 AGAAAAATACAGAAGGGAAATGG + Intergenic
1081886962 11:46506188-46506210 TAGAGTGGACAGAAGGGAGAAGG + Intronic
1082913012 11:58398033-58398055 TAAAGAATAGAGCAGAGAAAGGG + Intergenic
1083096690 11:60258254-60258276 CAAAGAATACAGAATGTAAAGGG - Intergenic
1083139898 11:60713270-60713292 TAAAGTACAGAGAAAGAAAAAGG + Intronic
1083388270 11:62328810-62328832 TAAAGTACACAGAGGGGAGAGGG + Intergenic
1085484844 11:76853777-76853799 TAAAATATACAGAAAAGTAAAGG + Intergenic
1085646529 11:78227053-78227075 TAAAAGAGAAAGAAGGGAAAGGG + Intronic
1085781999 11:79417999-79418021 TAAAGTATACTGTAGGAAAAGGG - Intronic
1085851212 11:80122527-80122549 TGAAGTAAATTGAAGGGAAAAGG - Intergenic
1086216431 11:84387734-84387756 TGAAGTATACGTAAGGCAAAGGG - Intronic
1086312413 11:85549439-85549461 AAAAGTATAAAGAAGAGAATTGG - Intronic
1086962148 11:92989365-92989387 TCAAGAATACACAATGGAAATGG + Intergenic
1087012937 11:93530379-93530401 AAAAGCATACAGAAAGGAAAGGG + Intronic
1087248129 11:95864262-95864284 AAGAGTATACAGGAGGGAAAAGG + Intronic
1087526935 11:99326753-99326775 CAAAGTATAAAGAAGGGAAGGGG + Intronic
1087586150 11:100124363-100124385 TAAACTATACATAAGGGCAAAGG + Intronic
1088041729 11:105393230-105393252 CAAAGTATACAGAGTGGAAGAGG - Intergenic
1088455291 11:110027020-110027042 TAAATTATACAACAGAGAAAGGG + Intergenic
1088958985 11:114642049-114642071 CAAAGAATACAGCATGGAAAAGG + Intergenic
1089043341 11:115475148-115475170 TAAAGTATACAGGAGAGTATGGG - Intronic
1089618954 11:119711593-119711615 TAAACAACACAGAAGGGGAAGGG + Intronic
1089689248 11:120176683-120176705 TCAAATATAGAGAAGTGAAATGG + Intronic
1089710293 11:120309714-120309736 TATAGTATAAAGAAGGGCGAGGG + Intronic
1091007444 11:131966400-131966422 TAAAGTCTACAGTATGCAAAAGG + Intronic
1092669035 12:10841491-10841513 TAAAGAAAACACAATGGAAAGGG - Intronic
1092788992 12:12055684-12055706 TAGAGAATACAGAAGTCAAATGG + Intronic
1094048436 12:26193981-26194003 TAAAGCAAACAGCAGGGAATTGG + Intronic
1094076865 12:26486259-26486281 TTGTGTATACAGAAGAGAAATGG - Exonic
1094678252 12:32643406-32643428 CAGAGTATAAGGAAGGGAAATGG + Exonic
1095587804 12:43867426-43867448 AAGAGTATACAGATGGGACAAGG + Intronic
1095940659 12:47724764-47724786 TGAAGAATACAGAAGGGACCTGG - Intronic
1097315147 12:58163915-58163937 CAAAGTATTAAGAAGTGAAATGG - Intergenic
1097687171 12:62701989-62702011 TAAAGTAGACACAAGCTAAATGG + Intronic
1098124477 12:67276031-67276053 TAAAGAAGACAGACGGGAGAAGG - Intronic
1098184891 12:67885725-67885747 TTAGGTATAAGGAAGGGAAATGG + Intergenic
1098528857 12:71518006-71518028 TAAAGTCTCCAGATGGGAGATGG - Intronic
1098615073 12:72512797-72512819 AGAAGTATACAGGAAGGAAAAGG + Intronic
1098842909 12:75498121-75498143 GAAAGTATCCAGAAGGCTAAAGG + Exonic
1099007621 12:77252878-77252900 AAAAGAAAACATAAGGGAAATGG + Intergenic
1099255103 12:80306541-80306563 TAAAGAATAAAGAAGGGATGGGG + Intronic
1099670479 12:85685539-85685561 AAAATTATAAAGAAAGGAAATGG + Intergenic
1101101722 12:101400442-101400464 TAAAGAATAAAGAAGGGTAAAGG + Intronic
1101450724 12:104776173-104776195 TAAACTATAGAGAACAGAAAAGG - Intergenic
1101567080 12:105917638-105917660 CAAAGAATACAGCATGGAAAGGG + Intergenic
1102226429 12:111231810-111231832 TAAAGTATACAGGAGGGGCCAGG + Intronic
1103144895 12:118586994-118587016 TAAAGCAGAAAAAAGGGAAAGGG + Intergenic
1104802819 12:131566311-131566333 TAAAATAAACAGAATGAAAATGG - Intergenic
1105220934 13:18325991-18326013 TAAAGTAAATAGAAGAAAAAAGG + Intergenic
1105254639 13:18735295-18735317 TAATGGATATAGCAGGGAAATGG - Intergenic
1106601429 13:31190715-31190737 CAATGTACACAGCAGGGAAATGG + Intergenic
1106937956 13:34745422-34745444 TAAAGTAAACAGGTGGAAAAAGG - Intergenic
1107128702 13:36872084-36872106 GAAAGCATATGGAAGGGAAAGGG - Intronic
1107237817 13:38193952-38193974 GGAAGGATACAGAACGGAAAAGG + Intergenic
1107349004 13:39494398-39494420 TGAAGGATACAGAAGGTAAGTGG + Intronic
1108263964 13:48685709-48685731 TAATGTTAACAGAAGAGAAAGGG - Intronic
1108813826 13:54266885-54266907 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
1109036962 13:57275806-57275828 TAATTTAAAAAGAAGGGAAAGGG - Intergenic
1109260090 13:60135014-60135036 TAAAAGATACAGAAAGTAAAAGG + Intronic
1110326562 13:74223070-74223092 AGATGTTTACAGAAGGGAAAAGG - Intergenic
1110423287 13:75337369-75337391 TAAAGTATACATCTTGGAAAGGG - Intronic
1110637790 13:77786663-77786685 AAAAGTATACAGTTGGGACAGGG - Intergenic
1110982183 13:81914998-81915020 TAAATTATATAGAAGCTAAAAGG + Intergenic
1111365818 13:87243302-87243324 AAAAGTATAAATAAGGGAAGAGG + Intergenic
1111468150 13:88644304-88644326 TAAAATATAAAGGAGGGAAGAGG - Intergenic
1112008991 13:95278256-95278278 TGAAGTATACATAAGGTATACGG - Intronic
1112138467 13:96611072-96611094 TAAAGAAAACAAAAGGAAAAAGG - Intronic
1112321239 13:98409600-98409622 TAAAATATACATAAGAGCAAAGG + Intronic
1112833913 13:103490295-103490317 TAAAGTACTCAGAGAGGAAATGG + Intergenic
1112855326 13:103761687-103761709 TAAAGTATAGAAAAGAGACATGG - Intergenic
1113126838 13:106988518-106988540 TAAAGTCAACAGAATGGCAATGG - Intergenic
1113923529 13:113928064-113928086 TCAAGTATTTAAAAGGGAAATGG + Intergenic
1114667376 14:24387293-24387315 AAAAGAATGCAGTAGGGAAAGGG - Intergenic
1114853261 14:26406324-26406346 TAAAGCACAGAGAAGGGAAGTGG + Intergenic
1115144828 14:30214505-30214527 TAAATTAAACATAAGGGAAAAGG - Intergenic
1116391407 14:44395248-44395270 CAAAGAATACAGAAGAGACATGG - Intergenic
1116631915 14:47346895-47346917 TGAAGTATACAGAGTGGGAACGG + Intronic
1116666525 14:47782639-47782661 TACAGTATAGAGCAGGGATATGG + Intergenic
1117284857 14:54277381-54277403 TTATGTATCCAGAAAGGAAATGG - Intergenic
1117319483 14:54607358-54607380 AGAAGTATACAGGATGGAAAGGG + Intronic
1119362968 14:74067252-74067274 TACAGTATAAAGAGAGGAAATGG + Intronic
1119504716 14:75162587-75162609 TAAAGAACACAGAATAGAAAGGG + Intronic
1119801564 14:77449760-77449782 TAAAGAACACAAGAGGGAAAAGG + Intronic
1120304618 14:82752788-82752810 TAAAGAAAACATAAGGGAAGAGG + Intergenic
1120325021 14:83013299-83013321 TAAAGTATACAAAGAGAAAAAGG - Intergenic
1120854762 14:89203015-89203037 TAAAGTTTAAAAAAGGGAAATGG - Intronic
1123394583 15:19918750-19918772 AAAAATATACAGAAGAGTAAGGG + Intergenic
1123873838 15:24603759-24603781 AAAAGTAGACAGTAGGGGAAGGG + Intergenic
1123887396 15:24740179-24740201 TTAAATATACAGCATGGAAACGG - Intergenic
1123977530 15:25567408-25567430 ATAAGTATACAGAATGGCAAGGG - Intergenic
1123996936 15:25725334-25725356 TAAAGTATAGAGGAGGGTATAGG + Intronic
1124268801 15:28262113-28262135 GAAAGTAGGAAGAAGGGAAAAGG - Intronic
1124659654 15:31536091-31536113 TACAGGAAACAGGAGGGAAATGG + Intronic
1126445241 15:48735783-48735805 TAAAGCAAACAGAAGGAAGAGGG + Intronic
1127180702 15:56414173-56414195 TTAAGAAAACAGAAGGAAAATGG + Intronic
1127423375 15:58831076-58831098 TAAAATATACAGAAGTGATCCGG - Intronic
1128035526 15:64521850-64521872 TAAAGAATAATGAAGGGACAGGG - Intronic
1128353044 15:66904464-66904486 TAAAATATACAGAACATAAAAGG + Intergenic
1128618628 15:69130224-69130246 TAAAAGAAACAGAAGAGAAAAGG - Intergenic
1128921115 15:71611224-71611246 CAGAGGATACACAAGGGAAATGG - Intronic
1129201101 15:74000601-74000623 TAAAGTATACAGGAGGGGATGGG - Intronic
1130570659 15:85040458-85040480 TAGAGAAGACAGAAAGGAAAAGG - Intronic
1130817363 15:87451959-87451981 TTAAGTATACATAAGCCAAAAGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132520861 16:387907-387929 CAAAGTATAGAGAAGGAAAGGGG + Intergenic
1134532648 16:14996537-14996559 TTAAGAATAGAGAAAGGAAAAGG + Intronic
1134819063 16:17230762-17230784 TAAAGCATAGAGAAGAGAATAGG - Intronic
1135661271 16:24299055-24299077 CAAAGAATACAATAGGGAAAGGG - Intronic
1137476212 16:48811640-48811662 TCAAGTAAACAGAAAGGAGAAGG - Intergenic
1137938829 16:52661162-52661184 TAAAGTAAATAGATGGAAAAAGG + Intergenic
1138056338 16:53838076-53838098 GAAAGGAGACAGAAGGCAAAAGG - Intronic
1138315468 16:56065940-56065962 TAAAGAATACAGAAGTGCACAGG - Intergenic
1138776195 16:59726871-59726893 TAAATTATACAGGAGAAAAAGGG + Intronic
1139003279 16:62540262-62540284 TAAATAATACAGAAGGGATAGGG + Intergenic
1139271462 16:65687326-65687348 TAAAGAATACAGAAGGAGAGGGG + Intergenic
1139331193 16:66192131-66192153 AAAAGTATACATACAGGAAAGGG + Intergenic
1140808676 16:78556527-78556549 TAAAGTATCTACAATGGAAATGG + Intronic
1144148224 17:12418998-12419020 AAAATTATACAGAAAGTAAAAGG - Intergenic
1144222753 17:13114808-13114830 TCATGTTTACTGAAGGGAAAGGG + Intergenic
1145213196 17:21031317-21031339 TAAAGTACACAGCAATGAAAAGG + Intronic
1145805951 17:27730037-27730059 TAAAGTTTTCACAGGGGAAAGGG - Intergenic
1147200967 17:38800724-38800746 GAAAGAATAGAGAAGGGAAAAGG + Exonic
1150506199 17:65701344-65701366 TAAAATATACAGAAAGGAAGGGG + Intronic
1151112639 17:71697100-71697122 TAAAGAATACAGTATGGAAAAGG + Intergenic
1151162852 17:72180446-72180468 TAAAGTCTGCAGAAGAGACATGG - Intergenic
1152557086 17:81058834-81058856 AAAAGTAGAAAGAAGGGAACAGG - Intronic
1153370177 18:4306493-4306515 TAAAGAAGAAAGGAGGGAAAGGG + Intronic
1153546935 18:6217762-6217784 AAATGTATCCAAAAGGGAAAGGG - Intronic
1153985581 18:10347819-10347841 TAAAGTTTACAAAAGGGATTGGG + Intergenic
1154436390 18:14345327-14345349 TAATGGATATAGCAGGGAAATGG + Intergenic
1155377997 18:25182520-25182542 TTAAGTATACATGAAGGAAAAGG - Intronic
1155633653 18:27924549-27924571 TAAAGTATGTAGAAGTTAAAAGG - Intergenic
1156027402 18:32670338-32670360 TAATAAATAAAGAAGGGAAAGGG + Intergenic
1156204134 18:34867668-34867690 GAAAGTATCCCCAAGGGAAATGG - Intronic
1156221806 18:35060238-35060260 GAAAGTAAACAGAAGGCATATGG + Intronic
1156684253 18:39625553-39625575 TAAATTATAATGAAGGAAAATGG - Intergenic
1156848274 18:41695329-41695351 TAAACTATTCAGTAGGAAAAGGG - Intergenic
1157057576 18:44249041-44249063 GAATGTATACAGTAGGAAAATGG + Intergenic
1157125246 18:44950425-44950447 TTGACAATACAGAAGGGAAAAGG + Exonic
1157294706 18:46433938-46433960 TAAAGAATACCAAAAGGAAATGG + Intronic
1158050326 18:53210177-53210199 TGAAGTAGACAGAAAGGAACTGG - Intronic
1158904550 18:61999709-61999731 TAAAGGAAGAAGAAGGGAAAAGG + Intergenic
1159305536 18:66637086-66637108 TAAAGTATACAGAAGCAGAAGGG - Intergenic
1159498979 18:69243683-69243705 TAAAGTATAAATAATGCAAAGGG + Intergenic
1159701041 18:71627607-71627629 AAAAGTATCCAGATTGGAAATGG + Intergenic
1160699614 19:499577-499599 GAAACGAAACAGAAGGGAAAGGG - Intronic
1161352309 19:3800661-3800683 AAAAGAAAGCAGAAGGGAAATGG + Intronic
1161965810 19:7547956-7547978 TAAAGTATACTGAAGGGGCTGGG - Intronic
1162986897 19:14276643-14276665 GAAAGAATACACAAGAGAAAAGG - Intergenic
1165678265 19:37747551-37747573 TAAAGAGTAGAGAATGGAAAAGG + Intronic
1166259384 19:41627190-41627212 TAATGTACACAGAAGAGAAAGGG - Intronic
1167834127 19:52052585-52052607 CAAAGTATAGAGAAAGAAAAGGG - Intronic
924978270 2:197447-197469 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978281 2:197499-197521 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978298 2:197603-197625 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978309 2:197655-197677 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978320 2:197707-197729 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978331 2:197759-197781 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978352 2:197863-197885 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978363 2:197915-197937 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978374 2:197967-197989 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978385 2:198019-198041 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978396 2:198071-198093 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978427 2:198227-198249 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978438 2:198279-198301 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978449 2:198331-198353 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978460 2:198383-198405 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978471 2:198435-198457 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978482 2:198487-198509 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978493 2:198539-198561 AAAGGAAGACAGAAGGGAAAAGG - Intergenic
925369951 2:3337032-3337054 AAAAGAAAAGAGAAGGGAAAAGG + Intronic
925402259 2:3583758-3583780 TAATGTACCTAGAAGGGAAAAGG - Intergenic
925424680 2:3739255-3739277 TAAATGATACAGAAGGGGGAAGG + Intronic
925607159 2:5671363-5671385 AAAAGTAAAGAGAAAGGAAAAGG - Intergenic
926487093 2:13475325-13475347 TAATGCAGACAGAAGGGAATAGG - Intergenic
926926203 2:17990134-17990156 TAAAGTGTACAGTATGGAAAGGG + Intronic
927271530 2:21215303-21215325 TAGAATATACAAAAAGGAAATGG - Intergenic
927902920 2:26834568-26834590 TAAAAGATACAGATTGGAAAAGG + Intergenic
928527090 2:32152161-32152183 TAATGTATACAACAGGAAAAAGG - Intronic
928844391 2:35652229-35652251 TAGATTACACAGAAGGTAAAAGG + Intergenic
928891860 2:36213468-36213490 TTAAGTTTACAGCAGGGCAAGGG - Intergenic
929101330 2:38317415-38317437 TAAATTATACAGAAAAGAAATGG + Intronic
929379278 2:41331187-41331209 TGAAGTATAAAGAGGGAAAAAGG - Intergenic
929736239 2:44552986-44553008 GAAAGTATACATAAGGCGAAAGG + Intronic
929912561 2:46102932-46102954 CAAAGAATACAGTATGGAAAAGG - Intronic
930173319 2:48274481-48274503 TAGAGTATAAAGAAGAGAACTGG - Intergenic
930702664 2:54474703-54474725 AAAAATATACAAAAGGGATAAGG + Intronic
930850617 2:55956758-55956780 TAAAGTATACAGGACTGAGATGG - Intergenic
931096401 2:58945604-58945626 TAAAGAATCAAGAAGAGAAAAGG - Intergenic
931848445 2:66228959-66228981 TCTAGTACACAGAAGAGAAAAGG - Intergenic
932183354 2:69669676-69669698 TAAAGAATATAGAAGGTACATGG - Intronic
932390899 2:71389977-71389999 TAAAGTCTCCTGAAGTGAAAAGG + Intronic
933229404 2:79789122-79789144 TAAAGTACACAACAGAGAAAAGG + Intronic
933315006 2:80704998-80705020 TAAAGCATACACAAGGAAGAAGG + Intergenic
933626048 2:84600793-84600815 CAAAGAATACAGTATGGAAAGGG - Intronic
934183120 2:89646468-89646490 TAAAGTAAATAGAAGAAAAAAGG - Intergenic
934293404 2:91720654-91720676 TAAAGTAAATAGAAGAAAAAAGG - Intergenic
934489606 2:94752152-94752174 TAACGGATATAGCAGGGAAATGG - Intergenic
934897295 2:98129965-98129987 CAAAGTATAGAGAAAGAAAAAGG + Intronic
934936373 2:98468950-98468972 TAAAGTGAACAGCTGGGAAAAGG + Intronic
935383800 2:102480217-102480239 TAAAAAATACAGGAGGGAAAAGG - Intronic
936643909 2:114347403-114347425 TAACGTAAACAAAAGGAAAAGGG - Intergenic
936693567 2:114921898-114921920 AAAAGTTTAAACAAGGGAAAAGG - Intronic
936760553 2:115775366-115775388 CAAAGTATAAATAATGGAAAGGG + Intronic
937190823 2:120096434-120096456 AAAAGTATACAGCACAGAAAAGG - Intronic
937602262 2:123752920-123752942 TAAACTATTAAGAAGGGAAGTGG + Intergenic
937673928 2:124568307-124568329 TGAAGTAGACAAAAGGAAAAGGG + Intronic
938037838 2:128051045-128051067 TAAAGTAAAGGGGAGGGAAAAGG - Intergenic
938696069 2:133836768-133836790 AAAGGTATCCAGAAGGAAAAGGG - Intergenic
940534277 2:154919144-154919166 TAAACAATCAAGAAGGGAAAAGG - Intergenic
940633231 2:156264661-156264683 TAAAGTATATGGAAGGAAAAGGG + Intergenic
941600610 2:167538520-167538542 TATATTATACAGAAGCAAAAAGG - Intergenic
942124287 2:172808176-172808198 TATAGTAAACAGTATGGAAATGG - Intronic
942425934 2:175860693-175860715 GAAAGTACAAAGATGGGAAAAGG + Intergenic
942442773 2:176053160-176053182 TAAAGTATGAAGAAGGAAACTGG - Intergenic
942675516 2:178422531-178422553 CAAAGTATCCATAATGGAAAAGG - Intergenic
943183827 2:184578831-184578853 TAAAGAGTACAGTATGGAAAGGG + Intergenic
943535117 2:189139033-189139055 CAAAGGGTACAGAATGGAAAAGG + Intronic
943584301 2:189719918-189719940 GGAAGAATACAGCAGGGAAAAGG + Intronic
943977617 2:194504426-194504448 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
944244789 2:197520119-197520141 AAAAGTATACAGAAAAGAAAAGG - Intronic
944799252 2:203221197-203221219 TAAAATATACATAAAGGCAAAGG - Intronic
944837839 2:203597522-203597544 TAAAGGAGAGAGAAGGAAAAAGG + Intergenic
945664849 2:212727974-212727996 TTAAGTATGCAGAAAGGACAAGG + Intergenic
946348176 2:219128399-219128421 GAAAGTTTTCAGAAGGGAAGAGG + Intronic
946780752 2:223191337-223191359 CAAAGTATAGAGAAAGAAAAAGG - Intronic
946826696 2:223686490-223686512 TAAAATATACAGAAGTGAATAGG + Intergenic
947019233 2:225656319-225656341 TTAAGTATACAGAAGGGACTGGG - Intergenic
947334156 2:229064015-229064037 TAAAGTCTAAAGAACTGAAAAGG + Intronic
947781337 2:232767013-232767035 TAAACTGGACATAAGGGAAAGGG + Exonic
948501012 2:238394275-238394297 AAATGTATACAGAAAGGCAAAGG - Intronic
949024670 2:241761241-241761263 TAAAGTATACAGGAGGGGCCGGG + Intronic
1169563076 20:6822952-6822974 TAAAGAAAACAGAAGTGAATTGG + Intergenic
1169678895 20:8187196-8187218 CAAAGTACACAGAAGGCAATTGG - Intronic
1169863719 20:10177645-10177667 CAAAGAATACAGGATGGAAAGGG - Intergenic
1170232216 20:14062486-14062508 TCAAGGGGACAGAAGGGAAATGG + Intronic
1170297055 20:14839285-14839307 TAAAGTATTAAGAAGCTAAAAGG - Intronic
1171161190 20:22925209-22925231 TTAAGTAGACACAAAGGAAAAGG - Intergenic
1172924579 20:38521036-38521058 TAAAGTATACAGACTGGCATAGG + Intronic
1173295437 20:41751238-41751260 TAACTTATAAAGAAGAGAAATGG - Intergenic
1174669188 20:52290651-52290673 AAAAATATCTAGAAGGGAAAGGG - Intergenic
1174764795 20:53242997-53243019 TAAGGTATACAAAAGAAAAATGG + Intronic
1174852874 20:54013003-54013025 AAAAATATACAGCAGAGAAAAGG - Intronic
1174884946 20:54323483-54323505 TAATGGATACAGGGGGGAAATGG - Intergenic
1175309919 20:58004734-58004756 GAAAGAAAAGAGAAGGGAAAGGG - Intergenic
1175355312 20:58361377-58361399 TAAGATATACAACAGGGAAAAGG - Exonic
1176702745 21:10076501-10076523 TAAAGAATTCAAAAGGCAAAAGG + Intergenic
1176840651 21:13840329-13840351 TAATGGATATAGCAGGGAAATGG - Intergenic
1176888087 21:14281024-14281046 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
1176980288 21:15374277-15374299 TAAAGTATTCAGAGGGCAATGGG - Intergenic
1177534603 21:22407415-22407437 TAAAATAAAAAGATGGGAAAGGG + Intergenic
1177735125 21:25079593-25079615 TAAAGTATAGAGAAAGCAAGTGG - Intergenic
1177829021 21:26116309-26116331 TAAAGAATACTGAAGTGAAATGG + Intronic
1178164760 21:29961249-29961271 AAAAGTATAGAGAAAGGTAAAGG + Intergenic
1178240646 21:30896123-30896145 TATAGTTTACAAAAGAGAAAGGG - Intergenic
1180215802 21:46323359-46323381 TTTAGTAGACAGAAGAGAAATGG - Exonic
1181763339 22:25073029-25073051 CAAAGAATGCAGAAGGGAAGGGG - Intronic
1183153653 22:36057271-36057293 AAGTGTATACTGAAGGGAAAGGG + Intergenic
1183772137 22:39936008-39936030 TTAAGTGAACAGAAGGGAAGAGG + Intronic
949214836 3:1553456-1553478 TAAAGGTTCCAGAAGAGAAAAGG + Intergenic
949547110 3:5081711-5081733 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
949832925 3:8235795-8235817 AAAAGAATACAGTATGGAAAGGG + Intergenic
949845213 3:8362781-8362803 TGCAGGATACAGAAAGGAAAGGG - Intergenic
949972749 3:9424988-9425010 TAAACTAGACACAAGGAAAATGG + Intronic
950370019 3:12521250-12521272 TCAAGAATACAGAAGTGAACAGG + Intronic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950615418 3:14154035-14154057 TAAGGAAAACAGCAGGGAAATGG + Intronic
951089399 3:18554765-18554787 AAATGTACACAGAAGAGAAAGGG + Intergenic
951192278 3:19785001-19785023 AAAAGTATAGAGTTGGGAAATGG + Intergenic
951214070 3:20007165-20007187 TAAAGTATACAGGAGGGCCCGGG - Intronic
951623242 3:24629771-24629793 CAAAGAGTACAGTAGGGAAAAGG - Intergenic
952130934 3:30362133-30362155 TAATTTATAAAGAAGGAAAAGGG + Intergenic
953481804 3:43258389-43258411 CAAAGTATAGAGAAAGAAAAGGG + Intergenic
953589629 3:44239093-44239115 TAAAGTATACAGAAGGATGTGGG - Intergenic
953867340 3:46595680-46595702 CAAAGTATACAGCTTGGAAAGGG - Intronic
954832302 3:53432426-53432448 TACAGTATACAGCAGGGACAGGG - Intergenic
955246916 3:57233704-57233726 TATAGTATAAAGAAGGGGAAAGG - Intronic
956050859 3:65246831-65246853 TAAAGAAAACCGAATGGAAATGG - Intergenic
956392407 3:68787531-68787553 TAAAGAAGAAAGAAGGGAAGAGG + Intronic
956426194 3:69138206-69138228 TAAAGACTATAGAAGGGAATAGG - Intergenic
956948353 3:74251263-74251285 TAAAATATACACAACTGAAATGG - Intergenic
956996592 3:74832779-74832801 TGAGGAATACAGAGGGGAAAAGG - Intergenic
957021720 3:75135623-75135645 TGAAGTCTACAGAAGGTAAGTGG + Intergenic
957609696 3:82451099-82451121 GAAAGTGTACAGAAGACAAAAGG + Intergenic
958194638 3:90228203-90228225 TAAAGTATGGAGTAGGGACAGGG - Intergenic
959369470 3:105504876-105504898 TAAATGATACAGAAGGGGGAAGG - Intronic
959491016 3:106988884-106988906 GAAAGTATGCTGAAGGAAAATGG + Intergenic
959665202 3:108912877-108912899 CAAAGTAAACAAAACGGAAATGG + Intronic
959864352 3:111249215-111249237 TAAAGGATAAAGAAGTGTAATGG - Intronic
960024682 3:112994970-112994992 AAAAGAAGACAGAAGGGAAATGG - Intronic
960913889 3:122678506-122678528 TGAGGTATAAAGGAGGGAAAGGG - Intergenic
961093774 3:124137763-124137785 TGAGGTCTAGAGAAGGGAAAAGG + Intronic
961338552 3:126201021-126201043 TAAAATACACAGAAGTGGAATGG - Intergenic
961845205 3:129757156-129757178 TAAAGAAAACAGGAGTGAAAGGG - Intronic
962018957 3:131476745-131476767 GAAAGTGTACTGAGGGGAAATGG - Intronic
962070983 3:132033932-132033954 TAAAGTAGCCAGAAGGAAAGGGG - Intronic
962131444 3:132682038-132682060 TGAATTATACAAAAGGGCAATGG - Exonic
962453425 3:135541363-135541385 TAAAGAATACAGTATGAAAAGGG - Intergenic
962557160 3:136565140-136565162 GAAAGGAAAGAGAAGGGAAAGGG + Intronic
962576743 3:136761915-136761937 TAAAATATTCAGGAGGCAAAAGG - Intergenic
962933104 3:140055672-140055694 TCAAGGAGACAGAAGGAAAAAGG - Intronic
963014667 3:140810324-140810346 TATACTAAACAGAAGGAAAATGG - Intergenic
963124539 3:141802935-141802957 TAGAATATGCAGAAGGGAAAAGG - Intronic
963276797 3:143339495-143339517 TAAAGAAGATAGCAGGGAAAAGG - Intronic
964311126 3:155393811-155393833 TAAATTTAACAGAATGGAAATGG - Intronic
964424065 3:156533629-156533651 TAAAGTAGAATGAAGGGCAAGGG + Intronic
964587108 3:158318395-158318417 CAAACTAAACAGTAGGGAAAAGG - Intronic
964695694 3:159505353-159505375 AAATTTATACAGAAAGGAAAAGG + Intronic
965354990 3:167662858-167662880 TAAAGTAAACAAAGGTGAAATGG - Intergenic
965861186 3:173152723-173152745 TAAGGTATACAGATTGGAAAAGG - Intergenic
966149734 3:176854092-176854114 TACAGTATACAGAATCAAAATGG + Intergenic
966552743 3:181223283-181223305 TAAAGCACACAGAAGATAAATGG - Intergenic
966618928 3:181943291-181943313 TAAAGTAAACAGCAGGGGAGAGG - Intergenic
967558556 3:190890503-190890525 GAAGATATACAGAATGGAAATGG - Intronic
967738568 3:192980588-192980610 TAAAGTATAATGAAGGGAAAAGG + Intergenic
967988901 3:195116693-195116715 AAAACTGTGCAGAAGGGAAAGGG + Intronic
968180350 3:196590667-196590689 TAATGTAGACAGAATGAAAAAGG + Intergenic
968791360 4:2665479-2665501 AAAAGAAAAGAGAAGGGAAAGGG - Intronic
970272730 4:14364693-14364715 AACAGTATACAGAAGAAAAATGG - Intergenic
970379678 4:15494245-15494267 TGAAGTATAAAGAAGAGCAAGGG + Intronic
970961757 4:21879607-21879629 GAAAGTATCAAGAAGGAAAATGG + Intronic
971984069 4:33796513-33796535 TAAATTATTCAGAATAGAAAAGG + Intergenic
972021991 4:34326919-34326941 TAAAGAATTCAGAAGAGGAAGGG + Intergenic
972038934 4:34565495-34565517 TAAATAATACAAAAGGAAAAAGG - Intergenic
972380999 4:38520379-38520401 CAAAGAGTACAGTAGGGAAAGGG + Intergenic
972673685 4:41238680-41238702 TAAAGTATACTAAATGTAAATGG - Intergenic
972975552 4:44630433-44630455 GAAACTACACAGAGGGGAAAAGG + Intronic
973532633 4:51848398-51848420 TAAAACAAAAAGAAGGGAAAAGG - Intronic
973655600 4:53044533-53044555 TAAAGTATATAGAAGGAGAAAGG - Intronic
973783788 4:54316331-54316353 AAAAGCAGACAGAAGGAAAATGG - Intergenic
974198440 4:58607597-58607619 TAAAACATACAGAAGGAAGAAGG - Intergenic
974590380 4:63941291-63941313 AAAAATATACATAAGTGAAATGG - Intergenic
974666318 4:64967330-64967352 TAAAGCAGAAAGAAGGGAAAAGG + Intergenic
974870223 4:67633605-67633627 TAAAGAAGAAGGAAGGGAAAAGG - Intronic
975208555 4:71672317-71672339 TAAAGTAGAGAGAGGGGATAAGG + Intergenic
975368843 4:73560436-73560458 GAGAGTATTCAGAACGGAAAAGG + Intergenic
975517496 4:75262461-75262483 TAAAGTAAAGAGGTGGGAAAAGG + Intergenic
976020194 4:80614105-80614127 TTATGTATACAGAAATGAAAAGG - Intronic
976432262 4:84976051-84976073 TAAAGTATCCAGTAGGCAACTGG - Intergenic
976590784 4:86848012-86848034 TAAAGTGTAAATAAGGGACAAGG + Intronic
976603169 4:86957943-86957965 TAAAGTATGAAGAAGTGAAATGG - Intronic
976865405 4:89719833-89719855 TACAGTGTCCAGAAGGCAAAAGG + Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977455102 4:97249062-97249084 TAAAGTACAGAAAAGAGAAAAGG - Intronic
978264929 4:106812383-106812405 AAAAGAATACAGAAGGAAAGAGG - Intergenic
978311008 4:107385004-107385026 AAGAGAATGCAGAAGGGAAATGG + Intergenic
978582571 4:110246938-110246960 AGAAGTATAAAGAAGGGAAGGGG + Intergenic
979095367 4:116542602-116542624 CAAAGAATACAGCATGGAAAGGG - Intergenic
979227456 4:118304769-118304791 TAAAGTGAACAGAAAGTAAAAGG - Intronic
979423681 4:120538006-120538028 CAAAGTGTACAGTATGGAAAAGG - Intergenic
979794420 4:124828994-124829016 TATATTAATCAGAAGGGAAAAGG - Intergenic
980332683 4:131429863-131429885 TAAAGTAAAGAGAAGGGGTAGGG - Intergenic
980374932 4:131932882-131932904 TAAAGAATTCAAAAGGCAAAAGG + Intergenic
980661599 4:135866314-135866336 TAAAATATAAAGAATGTAAAGGG - Intergenic
981160471 4:141492145-141492167 TTAAGTATACAGAAGAGGAACGG - Intergenic
981393744 4:144221492-144221514 TCAAGGATACAAAACGGAAAAGG - Intergenic
981454577 4:144938710-144938732 GAAAATATAAAGCAGGGAAAGGG + Intergenic
981884261 4:149653982-149654004 TTAAGACTACAGAAAGGAAAAGG + Intergenic
981971125 4:150662995-150663017 TAAAATCTACAGAAGATAAAAGG + Intronic
982326254 4:154131766-154131788 TACAATATACAGAATGAAAAAGG + Intergenic
982363971 4:154555090-154555112 TTAAAAATACAGCAGGGAAAGGG + Intergenic
982395233 4:154908865-154908887 TAAAGGATAGAAAAGGAAAAGGG - Intergenic
982578627 4:157149558-157149580 TAAAGAATACTAAAAGGAAAGGG - Intronic
983010707 4:162542835-162542857 TAAAGAATCCAGAACAGAAAAGG - Intergenic
983070620 4:163263956-163263978 TAAAATATAAAGCAGTGAAAAGG + Intergenic
984258795 4:177419313-177419335 TAAGGTCTACAGAAGGAAATGGG + Intergenic
984555949 4:181213935-181213957 TGAAGTATACAGGAAGAAAAAGG - Intergenic
984689574 4:182710310-182710332 TAAAGTATATAGCATGGAGAAGG + Intronic
985818072 5:2141565-2141587 TAAAATTTACATTAGGGAAATGG + Intergenic
986645850 5:9915313-9915335 TTCAGTTTACAGAAGGAAAATGG + Intergenic
987218442 5:15764454-15764476 TAAAGAAGTAAGAAGGGAAAAGG + Intronic
987823960 5:23004108-23004130 TAAAGCAGAAAGAAGAGAAAAGG - Intergenic
988406757 5:30833893-30833915 TAAGGTATAAAGAAGGGATCTGG - Intergenic
989223903 5:39003866-39003888 TAAATTATTGAGAAGGAAAATGG - Intronic
989796558 5:45481738-45481760 AAAAGATTACAAAAGGGAAAGGG - Intronic
989837337 5:46009037-46009059 AAAAGTATAAAGAAAGAAAAAGG + Intergenic
990686263 5:58304712-58304734 AAATGTATACAGAAAAGAAAAGG - Intergenic
992629097 5:78663772-78663794 TAAAGTATACAGAAGGATGCTGG + Intronic
993033258 5:82728862-82728884 CACAGTTTACAGAAGGAAAAGGG - Intergenic
993165514 5:84349057-84349079 TATAGTAAAGAGAAGAGAAAAGG - Intronic
993205627 5:84874775-84874797 TAAAGTGTATACAAGGAAAACGG - Intergenic
993393556 5:87353892-87353914 TGAAGTATATGGTAGGGAAATGG + Intronic
993473076 5:88330715-88330737 TAAAGGATACAGAAGCAAATGGG + Intergenic
993846032 5:92944656-92944678 CAACATTTACAGAAGGGAAAGGG - Intergenic
993905037 5:93612742-93612764 TCAAGTGTATAAAAGGGAAACGG + Intergenic
994238604 5:97393794-97393816 TAAAGTTTACAATAGGGATAGGG + Intergenic
994247181 5:97491007-97491029 TAAGGTTTACATAAGAGAAAAGG - Intergenic
994531932 5:100983133-100983155 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
994827865 5:104739094-104739116 TAAAATACAGAGAAGGAAAAAGG + Intergenic
995034577 5:107518651-107518673 TGAAGTATACCTAATGGAAATGG - Intronic
995252686 5:110012417-110012439 TAAAATATACACAGGAGAAATGG - Intergenic
995813223 5:116133551-116133573 TAAAGTATCCAGATGGTAAGAGG - Intronic
995863788 5:116669010-116669032 TGATGTATACAGAAGAGAGAGGG - Intergenic
996058524 5:119006866-119006888 CAAAGAATACAGCATGGAAAGGG + Intergenic
996564033 5:124861080-124861102 AAAGGTCTGCAGAAGGGAAAGGG + Intergenic
996591062 5:125148242-125148264 CAAAGTAAACAGATGAGAAACGG - Intergenic
996980193 5:129482326-129482348 CAAGGTATACAGAAGAAAAAAGG + Intronic
997495796 5:134324059-134324081 GAAAATATACAGATGGCAAATGG + Intronic
997811422 5:136974220-136974242 AAAAGTGGATAGAAGGGAAACGG + Intergenic
998888087 5:146715790-146715812 GATAGTATACAGAAGAGAATAGG - Intronic
998933853 5:147213185-147213207 TCAAGTATAAGGAAAGGAAAGGG + Intergenic
999539747 5:152558497-152558519 TGAAGTTTAGAGAGGGGAAAGGG - Intergenic
999934171 5:156467275-156467297 TAAAATATCCTCAAGGGAAAAGG + Intronic
1000205952 5:159058753-159058775 AAAATTAAACAGAAGGGAAGTGG - Intronic
1000362591 5:160461710-160461732 AAAAGTATTAGGAAGGGAAATGG + Intergenic
1000981287 5:167819714-167819736 TGAGCTATAGAGAAGGGAAATGG + Intronic
1000990157 5:167903564-167903586 TCAAGGAAACAGCAGGGAAAAGG + Intronic
1001092476 5:168751484-168751506 TAGATTATGCAGAAGGGAAATGG + Intronic
1002843284 6:924158-924180 TAAATGATACGGAAGGGAGAAGG + Intergenic
1003694208 6:8386982-8387004 AAATGTATACAGAGGGCAAATGG - Intergenic
1003701098 6:8466163-8466185 TAAATGATACAGAAGAGAAGTGG + Intergenic
1003831232 6:10014218-10014240 TAAAGTATACAGATGTGCATAGG - Intronic
1004432917 6:15562364-15562386 TGAAGTATACAGAAAGTCAAAGG - Intronic
1004662426 6:17722061-17722083 AAAAATGTACAGAAGGGAAGAGG - Intergenic
1005452373 6:25986056-25986078 TAAAGAATACAGAAGAAAATAGG + Exonic
1005917333 6:30364712-30364734 TGAAGACTACAAAAGGGAAAAGG - Intergenic
1006554244 6:34852156-34852178 GAAAGAAGACAGAAGAGAAAAGG - Intronic
1006871120 6:37253117-37253139 TGAAATGTACAGCAGGGAAAAGG - Intronic
1007056203 6:38887806-38887828 TACTGTAGTCAGAAGGGAAAGGG + Intronic
1007459672 6:42009048-42009070 TAAGGTATACAGAAGTGTAAGGG + Intronic
1007492345 6:42233214-42233236 TAAAGTATACAGAAGGGAAATGG - Intronic
1007981401 6:46163112-46163134 TAAAGTATGCCTAAGGGCAATGG + Intronic
1009543696 6:64999446-64999468 TAAATGATACAGAAGGGGGAAGG + Intronic
1010054383 6:71547502-71547524 TAAAGGATACAGAAGTGAAAAGG - Intergenic
1010205712 6:73321034-73321056 AAAAGAATACAGAATGGAGAAGG + Intergenic
1011076318 6:83443032-83443054 TAAAGCATGAAGAAAGGAAAGGG - Intergenic
1011208452 6:84927896-84927918 AAAAGTATATAAGAGGGAAAAGG + Intergenic
1011315921 6:86031023-86031045 TAAAGTTTACAGAAGAGGCAGGG - Intergenic
1011402255 6:86976200-86976222 GAAAGTAGCAAGAAGGGAAATGG + Intronic
1011403532 6:86990886-86990908 TAAAAAATAGAGCAGGGAAAGGG + Intronic
1011693549 6:89891659-89891681 CAAAGTATAGAGAAAGAAAAAGG - Intergenic
1012000654 6:93650517-93650539 TAAAGTATAAGGAGGGGAAAAGG + Intergenic
1012152980 6:95778819-95778841 CAAAGTAAACAAAAGGAAAATGG - Intergenic
1012668345 6:102007900-102007922 TGAAGTATAAGTAAGGGAAAGGG + Intronic
1012686260 6:102253830-102253852 TAAAAGAAACAGAAGTGAAATGG + Intergenic
1013118794 6:107123324-107123346 TTATCTATACAGAAAGGAAAGGG - Intergenic
1013832641 6:114292805-114292827 TAAAGTATACAGGAGGATATTGG - Intronic
1014309687 6:119784539-119784561 TAAAGTGAACAGAAAGGAAAAGG - Intergenic
1014315279 6:119856831-119856853 TAAAGTATACTAAAGAGAAATGG - Intergenic
1014396711 6:120932313-120932335 CAAAGTATAGAGAAAGAAAAAGG - Intergenic
1014653788 6:124073897-124073919 TAAAATATTCAAAAGGGAAATGG - Intronic
1014939982 6:127426543-127426565 GAAAGTAAACAGATGGAAAAAGG + Intergenic
1015583560 6:134752730-134752752 AAAATTATACAGAAGGTAAAGGG + Intergenic
1015629419 6:135216442-135216464 TAAAGTATACAGGAATGAACGGG - Intronic
1016772609 6:147869061-147869083 TTAAGTAAACAAAAGGAAAACGG + Intergenic
1017697586 6:157032865-157032887 TTAAGTAAAAAGAATGGAAAGGG - Intronic
1018305517 6:162450438-162450460 TGAAGAATACAGCATGGAAAGGG + Intronic
1018579045 6:165291735-165291757 TAAGGAGTACAGAAAGGAAATGG + Intronic
1020329309 7:7001860-7001882 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
1020574817 7:9913207-9913229 TAAAGGATACAGGAGTGTAAAGG - Intergenic
1020904581 7:14049236-14049258 TATAGTATACTGAAGAAAAAAGG - Intergenic
1020957395 7:14758830-14758852 TACAATATAAAGAAAGGAAATGG - Intronic
1021058076 7:16075475-16075497 GATAGTATACAGACGGCAAAGGG + Intergenic
1021084252 7:16402813-16402835 TACAGTATACATAAGGTAAGGGG + Intronic
1022971101 7:35518144-35518166 CAAAGACTACAGAAGGGGAAGGG + Intergenic
1022990420 7:35701808-35701830 AGTAGTATACAGAAGGAAAAAGG - Intergenic
1023090083 7:36609138-36609160 TAAAGTATACGGGATGGGAAGGG + Intronic
1023268083 7:38429581-38429603 TAAAGTATGCAGAAGAGCAAAGG + Intronic
1023573229 7:41594635-41594657 TCATGTATCCAGAAGGAAAAGGG + Intergenic
1023954674 7:44874853-44874875 TAAGGTATAAAGAAGGGAAAAGG - Intergenic
1024161209 7:46678375-46678397 TAAAGAATACTGAAGGGGGAAGG - Intronic
1024268204 7:47622503-47622525 TAAATGATACGGAAGGGGAAAGG - Intergenic
1024304284 7:47914035-47914057 TAAAGAAGAGAGAAGGGAAGAGG + Intronic
1024845063 7:53633440-53633462 TATAGGAGACAGAAGGGAAACGG + Intergenic
1024852498 7:53736650-53736672 TAAAGAATACTGTAGAGAAATGG + Intergenic
1027448013 7:78297158-78297180 CAAAGAGTACCGAAGGGAAAGGG + Intronic
1028135173 7:87217574-87217596 TAAATTCTACAGAATGGAGAAGG - Intronic
1028138769 7:87248821-87248843 TGCAGAATACAGAAGGGGAAAGG + Intergenic
1028281989 7:88941882-88941904 TTAAGTATATATAAGGCAAAAGG + Intronic
1028919538 7:96295934-96295956 TAAAGTACTCAGAAAAGAAAAGG - Intronic
1029749882 7:102537282-102537304 TAGAGTACACAAAAGGCAAAAGG - Intergenic
1029767832 7:102636388-102636410 TAGAGTACACAAAAGGCAAAAGG - Intronic
1029955603 7:104635862-104635884 GAATGTATCCAGGAGGGAAATGG + Intronic
1030216651 7:107050138-107050160 TAATGAAGTCAGAAGGGAAAGGG + Intronic
1031044463 7:116872252-116872274 GAAATGATTCAGAAGGGAAAAGG + Intronic
1031057977 7:117014741-117014763 TAATTAATACAGGAGGGAAATGG + Intronic
1031230545 7:119100332-119100354 CAAAGTATAGAGAAAGAAAATGG + Intergenic
1031253679 7:119420436-119420458 TAAACTATGAAGAAGGGAAAAGG + Intergenic
1031605716 7:123764565-123764587 TAAAGCATATAGTAGGGAGAAGG + Intergenic
1033002064 7:137516909-137516931 TAAAGAATAGAGTAGGGAAGGGG + Intronic
1033891768 7:146021683-146021705 TAAAGGAAACAGAAGGCATAGGG - Intergenic
1033915253 7:146316108-146316130 TAATTAATACAGAAGGCAAATGG - Intronic
1034146768 7:148880426-148880448 AAAAATATAAGGAAGGGAAAGGG - Intronic
1034595395 7:152185050-152185072 TAAAGTATACAGGAGGGGCCAGG - Intronic
1036774295 8:11599523-11599545 TAATTTATAAAGAAGAGAAATGG + Intergenic
1037097510 8:15003193-15003215 TAAAATTTACTGAAGGAAAATGG + Intronic
1037097648 8:15004638-15004660 TAAAATTTACTGAAGGAAAATGG - Intronic
1038269667 8:26064940-26064962 AAAAGAATTCAGGAGGGAAAGGG + Intergenic
1038726532 8:30087103-30087125 TAAAGTATACAGGAGGGGCTGGG + Intergenic
1039078838 8:33716256-33716278 TAAAATTTACAGATAGGAAATGG - Intergenic
1039331307 8:36540074-36540096 TAAAGACTACAGAATGGGAAGGG + Intergenic
1039493996 8:37967110-37967132 TAACTGAAACAGAAGGGAAAGGG - Intergenic
1039534538 8:38296468-38296490 TAAAGAATACAAAAAGCAAAAGG + Intronic
1040629087 8:49188708-49188730 GAATGTATACAGCATGGAAAGGG + Intergenic
1041177907 8:55216246-55216268 AAATGTATATGGAAGGGAAATGG + Intronic
1042129815 8:65577003-65577025 GAAAGTAAACAGATGGAAAAAGG - Intergenic
1043821973 8:84877844-84877866 TAAGGTATTCAGAACAGAAATGG - Intronic
1043867482 8:85392557-85392579 TAAAGTATACTACAGTGAAATGG - Intronic
1044377287 8:91491126-91491148 GAAAGTATACAGACGGTAACTGG + Intergenic
1044603508 8:94028893-94028915 TAATGTATGCAGAAGGAAAATGG + Intergenic
1044914091 8:97093717-97093739 CAAAGAATACAGAAAGGAAGAGG - Intronic
1045138516 8:99251136-99251158 AAAGGTATACAGATGGGAAATGG - Intronic
1045155778 8:99468962-99468984 TATAGTATATAGTAGGGAGAAGG - Intronic
1045716668 8:105055100-105055122 AAAATAATACAGAAGAGAAAAGG + Intronic
1045805787 8:106159674-106159696 TAAAGAATAATGAAGGAAAATGG - Intergenic
1045872554 8:106942835-106942857 TAAAGAATACAAAAGGAGAAGGG - Intergenic
1046342051 8:112871477-112871499 TATATTATAAAAAAGGGAAATGG + Intronic
1047077956 8:121425482-121425504 AAATGCATACAGATGGGAAAGGG + Intergenic
1047488586 8:125355334-125355356 AAAAGAGTAGAGAAGGGAAAGGG + Intronic
1047571970 8:126108929-126108951 TAAAGTAAACAGTAGAGCAAGGG + Intergenic
1047598415 8:126402230-126402252 GAAATTATAAAGAAGGAAAAAGG + Intergenic
1048492478 8:134906821-134906843 TAAAAAATAAAGAAGTGAAAGGG - Intergenic
1048688125 8:136927317-136927339 TAAAGCATAAAGAAAGGCAAAGG - Intergenic
1048728795 8:137414430-137414452 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
1050480680 9:6084288-6084310 AAGAGAACACAGAAGGGAAATGG + Intergenic
1050704117 9:8376560-8376582 TAAACAATAGAGAAGGGAAAGGG + Intronic
1051004873 9:12331442-12331464 TAAAGTATATAGTTTGGAAATGG + Intergenic
1051046581 9:12882649-12882671 GAAAGTATACAAAAAAGAAAAGG + Intergenic
1051471115 9:17443521-17443543 AAAAGTATAAAGAAAGGTAAGGG + Intronic
1051493083 9:17688957-17688979 TGAAGCATACAGAATGGAGAGGG + Intronic
1051581859 9:18685199-18685221 TAAAGTATACCTGAGGGCAAAGG + Intronic
1053177772 9:35941243-35941265 TCAAGTTAACATAAGGGAAAAGG - Intergenic
1053383243 9:37666489-37666511 TAAAGTGCACAGAAGGGAGATGG - Intronic
1053503951 9:38624288-38624310 AAAGGTATACAGATTGGAAAGGG - Intergenic
1053639945 9:40063226-40063248 TAAAGAATTCAAAAGGCAAAAGG + Intergenic
1053668189 9:40332109-40332131 TAATGGATATAGCAGGGAAATGG + Intergenic
1053766187 9:41402259-41402281 TAAAGAATTCAAAAGGCAAAAGG - Intergenic
1053917992 9:42958398-42958420 TAATGGATATAGCAGGGAAATGG + Intergenic
1054379334 9:64472160-64472182 TAATGGATATAGCAGGGAAATGG + Intergenic
1054516423 9:66044184-66044206 TAATGGATATAGCAGGGAAATGG - Intergenic
1054544803 9:66313415-66313437 TAAAGAATTCAAAAGGCAAAAGG - Intergenic
1054838988 9:69714817-69714839 TAAAATCTACAGAAGACAAAGGG + Intronic
1054927604 9:70604103-70604125 CACAGTTTACAGAAAGGAAAGGG + Intronic
1055298415 9:74857781-74857803 TAAAGTCTATGGAAGGAAAACGG + Intronic
1055298870 9:74862444-74862466 CAAAGGAGAAAGAAGGGAAATGG + Intronic
1055372355 9:75613621-75613643 AAAAGAAAACAGAAGGAAAATGG - Intergenic
1055599903 9:77904922-77904944 TAAATTATACAAAAGTGAAATGG + Intronic
1055884407 9:81043544-81043566 TTAAGTGTACAGCAGTGAAAAGG + Intergenic
1057224288 9:93280489-93280511 TTAAGTACACAGAAGTAAAATGG - Intronic
1057370198 9:94464535-94464557 TAGAGTATCCAGAAGGAAGAAGG + Intergenic
1057515706 9:95718700-95718722 TAAAAGATAGACAAGGGAAATGG - Intergenic
1059180906 9:112211233-112211255 GAACATATACAGAAGGAAAATGG - Intergenic
1059815824 9:117912597-117912619 TAGAATATACACAAAGGAAATGG + Intergenic
1060285960 9:122252744-122252766 TAAAGAATACAGATGGTCAAGGG + Intronic
1060546379 9:124463744-124463766 TAGAGTCTACAGATGTGAAAAGG - Intronic
1061699759 9:132406942-132406964 TAAAGGACCCAGAAGGAAAATGG - Intergenic
1061765074 9:132876727-132876749 AAAAGTATAAAAAATGGAAATGG + Intronic
1202787765 9_KI270719v1_random:46609-46631 TAAAGAATTCAAAAGGCAAAAGG + Intergenic
1186573619 X:10742114-10742136 TAATGAATACAGAAGGCATAAGG - Intronic
1186717073 X:12263557-12263579 TTAAGAATAGAGAAGGGAAGCGG + Intronic
1186975720 X:14902181-14902203 TAAAGTACATATAAGGAAAAAGG - Intronic
1188732624 X:33669581-33669603 TAATATATACAAAAGGGAACAGG + Intergenic
1188887779 X:35571548-35571570 TGAAATATACAGAATGCAAAAGG + Intergenic
1191142942 X:57135178-57135200 TAAAGGATACACAAAGGAAGAGG - Exonic
1191721615 X:64234025-64234047 TAAGGCATACAGATTGGAAAAGG - Intergenic
1192337305 X:70232759-70232781 TAAAGCATAAGGAAAGGAAAGGG + Intergenic
1192569827 X:72194102-72194124 TAAAGTCTACAGTAGGGGACGGG + Intronic
1193384107 X:80850646-80850668 TTAAGAAAACAAAAGGGAAAAGG - Intergenic
1193456278 X:81734880-81734902 AAAAATATACACTAGGGAAAGGG + Intergenic
1194339279 X:92689826-92689848 TGAAGCATACAGGAGGGACACGG + Intergenic
1195306610 X:103589170-103589192 CAAAGAATACAGTATGGAAAGGG - Intergenic
1195989477 X:110668328-110668350 TAAAGTATTTAAAAGTGAAAAGG + Intergenic
1196301102 X:114050670-114050692 TAAAGAAGAATGAAGGGAAAGGG + Intergenic
1196333988 X:114508463-114508485 AAAAATATACAGTAAGGAAAAGG + Intergenic
1196360571 X:114850863-114850885 TAAAGCATAAAGAAAGTAAAAGG + Intronic
1196809562 X:119618447-119618469 TGAAGTATTGAGAAGGGGAAGGG - Exonic
1197143463 X:123142900-123142922 TAAATAATACATAAGTGAAAAGG + Intergenic
1197373372 X:125652158-125652180 TCAAGAATACATAATGGAAAAGG - Intergenic
1197640767 X:128965786-128965808 TAAAGGATTCAGGAGAGAAATGG + Intergenic
1197641151 X:128969613-128969635 TAAAGGATTCAGGAGAGAAACGG + Intergenic
1197801510 X:130354414-130354436 TAAAGTATTAAGAATGAAAAAGG - Intronic
1198217778 X:134572006-134572028 AAAAGGAAACAGCAGGGAAAAGG + Intronic
1198915871 X:141671120-141671142 TTAAGTATACAGTTGGGAGAGGG - Intronic
1199525060 X:148782958-148782980 TAAAGTATAAATCAGGAAAAGGG + Intronic
1199913855 X:152317050-152317072 TAAAAGATACAGAATTGAAATGG + Intronic
1200647666 Y:5806607-5806629 TGAAGCATACAGGAGGGACACGG + Intergenic