ID: 1007495512

View in Genome Browser
Species Human (GRCh38)
Location 6:42257771-42257793
Sequence CTGGCCAAGAATTGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 282}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007495502_1007495512 18 Left 1007495502 6:42257730-42257752 CCTATGCAAAATTAAAGTACTTA 0: 1
1: 0
2: 3
3: 35
4: 303
Right 1007495512 6:42257771-42257793 CTGGCCAAGAATTGGGGAGGAGG 0: 1
1: 0
2: 1
3: 31
4: 282
1007495499_1007495512 28 Left 1007495499 6:42257720-42257742 CCACCCACTGCCTATGCAAAATT 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1007495512 6:42257771-42257793 CTGGCCAAGAATTGGGGAGGAGG 0: 1
1: 0
2: 1
3: 31
4: 282
1007495500_1007495512 25 Left 1007495500 6:42257723-42257745 CCCACTGCCTATGCAAAATTAAA 0: 1
1: 0
2: 1
3: 21
4: 261
Right 1007495512 6:42257771-42257793 CTGGCCAAGAATTGGGGAGGAGG 0: 1
1: 0
2: 1
3: 31
4: 282
1007495501_1007495512 24 Left 1007495501 6:42257724-42257746 CCACTGCCTATGCAAAATTAAAG 0: 1
1: 0
2: 0
3: 15
4: 234
Right 1007495512 6:42257771-42257793 CTGGCCAAGAATTGGGGAGGAGG 0: 1
1: 0
2: 1
3: 31
4: 282
1007495506_1007495512 -10 Left 1007495506 6:42257758-42257780 CCCATTTGGAGGACTGGCCAAGA 0: 1
1: 0
2: 0
3: 11
4: 86
Right 1007495512 6:42257771-42257793 CTGGCCAAGAATTGGGGAGGAGG 0: 1
1: 0
2: 1
3: 31
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007495512 Original CRISPR CTGGCCAAGAATTGGGGAGG AGG Intronic
900118797 1:1039968-1039990 CTGGGGAAGAGTTGGGGAGAGGG + Intronic
900653858 1:3745349-3745371 CTGGGGAAGACTTGAGGAGGGGG - Intergenic
900975122 1:6011951-6011973 CTGGCCTAGGATGGTGGAGGTGG + Intronic
901897109 1:12323468-12323490 CTGGCCAGGAATTGGGGTGGGGG - Intronic
902310548 1:15578593-15578615 CTGGCTTAGAAGAGGGGAGGAGG - Intronic
903179729 1:21599105-21599127 CTGGCAAAGAAAGGAGGAGGCGG + Intronic
903306644 1:22417626-22417648 CTGGCCAGGGACTGGGGAGTCGG + Intergenic
903528344 1:24010303-24010325 ATAGCCAGGAATTGGGGAGAGGG - Intergenic
904040918 1:27584616-27584638 CTGGCCACCAATGGGAGAGGTGG - Intronic
904801537 1:33096528-33096550 CTGGCCAAGAAGGTAGGAGGGGG - Intronic
905299313 1:36975651-36975673 CTGGGCAAAAATTGTGAAGGAGG + Intronic
905476632 1:38233341-38233363 CTGTGTGAGAATTGGGGAGGGGG - Intergenic
905817933 1:40966363-40966385 CAGGCCCAGAATTGGGAAAGAGG - Intergenic
905946013 1:41902027-41902049 CTGGCTAAGAAGTGAGGAGGGGG + Intronic
906212510 1:44019942-44019964 CTAGACAGGAAGTGGGGAGGGGG + Intronic
906805905 1:48778244-48778266 CTGGCCCAGAATCTGGCAGGTGG - Intronic
909491662 1:76233145-76233167 CTGTAGAAGAATTTGGGAGGAGG - Intronic
910333337 1:86100856-86100878 AAGGCAAAGAATTGGGGATGGGG - Intronic
911019935 1:93375844-93375866 CTGCCCAGGACTTGGGGTGGGGG + Intergenic
911155326 1:94630549-94630571 CTTGCCAGGAAGTGGGGAAGGGG - Intergenic
912724353 1:112045466-112045488 CTGGGCAAGGGTTGGGGATGCGG - Intergenic
913075295 1:115336861-115336883 CTGTGCATGGATTGGGGAGGAGG + Intronic
914228665 1:145744324-145744346 CTGGTTTTGAATTGGGGAGGAGG - Exonic
915126716 1:153670701-153670723 CGGGCCCAGGAGTGGGGAGGGGG - Intronic
915323698 1:155069941-155069963 CTGGCCTAGAACTGGGAAGGTGG + Intergenic
916608169 1:166363581-166363603 CTGGCCCAAAATGGGTGAGGAGG - Intergenic
919897382 1:202017856-202017878 CTAGCCAAGAAGTGGGGGAGGGG + Intergenic
920873250 1:209811777-209811799 CTTGCCTAGAGTTGGGGAGGGGG - Intergenic
920881728 1:209887082-209887104 CTGGCCATGAATTGGGGCAGTGG - Intergenic
921013650 1:211167615-211167637 CTGGCAAAGTAATGGGGAGAGGG + Intergenic
923020549 1:230160020-230160042 TTGGCCTAGGAGTGGGGAGGAGG - Intronic
923191723 1:231626758-231626780 CTGGACGGGAAGTGGGGAGGGGG - Intronic
923536349 1:234855014-234855036 CTGGCCAAGACTTGAGCAGGAGG + Intergenic
923961172 1:239085162-239085184 CTGGCCAGAACTCGGGGAGGGGG - Intergenic
1063730255 10:8688218-8688240 CTGGCCCAGATTTGGGGTTGAGG + Intergenic
1065312531 10:24430271-24430293 CTGACCAAGCATAGGGGAAGGGG - Intronic
1066436051 10:35397516-35397538 TTGGCCCTGGATTGGGGAGGAGG + Intronic
1068984091 10:63091005-63091027 GTGGCACAAAATTGGGGAGGGGG - Intergenic
1069756044 10:70774985-70775007 CTGCTGAGGAATTGGGGAGGAGG + Intronic
1069876575 10:71566829-71566851 ATGGCGAAGAATTGGGAGGGGGG - Intronic
1069950357 10:72014462-72014484 CAGGTTAAGATTTGGGGAGGGGG - Intergenic
1071328399 10:84538803-84538825 CAGGCCAGGGATTGGGGTGGGGG + Intergenic
1071712133 10:88060275-88060297 CTGGACTAGAATTGGGTGGGTGG - Intergenic
1075565609 10:123501705-123501727 GTAGACAAGACTTGGGGAGGAGG - Intergenic
1075931448 10:126300200-126300222 CTGGCCAAGAACTGGGGTCAGGG + Intronic
1076402085 10:130190963-130190985 CCGGCCCAGGCTTGGGGAGGCGG - Intergenic
1076880701 10:133237925-133237947 CGGGCCACGAGGTGGGGAGGAGG - Exonic
1077393743 11:2311261-2311283 TGGGGCAAGAGTTGGGGAGGTGG - Intronic
1077697806 11:4410913-4410935 CTGACCATGAATTGTGGGGGAGG + Intergenic
1079460707 11:20675578-20675600 CTGGCCAGGAATTTGGAATGTGG - Intronic
1081584872 11:44377257-44377279 CTGGCCCAGAGTAGAGGAGGAGG - Intergenic
1081633242 11:44703286-44703308 GTGGCCAGGAAATGGGAAGGAGG + Intergenic
1082784599 11:57309975-57309997 AGGGCCAAGATTTGGGGAAGAGG - Exonic
1083232540 11:61332565-61332587 GTGGCCAGGAAAAGGGGAGGTGG - Intronic
1084947007 11:72643602-72643624 CCGTCCAAGAGTTGGTGAGGAGG - Intronic
1085045897 11:73353198-73353220 CTGGCCAAGCTTTGGGGTAGGGG - Intronic
1087142648 11:94780437-94780459 CTTTCCAAGAATTTGGGATGAGG - Intronic
1089401382 11:118166526-118166548 CAGGCCAAGCACTGGGCAGGTGG + Exonic
1089692887 11:120197766-120197788 CTGGCCTGGGATTGGGGTGGAGG + Intergenic
1090240760 11:125179982-125180004 CAGGACATGAATTGGGGAGGAGG - Intronic
1090653541 11:128825848-128825870 CTTGCCAGGATTTGGGGAGGAGG - Intergenic
1091044631 11:132314722-132314744 CTGGGCAAGAAGAGGGGAGAGGG + Intronic
1091693384 12:2611831-2611853 CTGGGCAAAAGGTGGGGAGGAGG + Intronic
1091835554 12:3583282-3583304 CTGGCCTTGACTTGGGGAGAAGG + Intronic
1092001918 12:5039775-5039797 CTGGCCAAGGAATGGTGGGGAGG + Intergenic
1092518173 12:9237899-9237921 CAGGTCAGGAAGTGGGGAGGGGG + Intergenic
1093254861 12:16854515-16854537 CTAGGTAAGAATTGGAGAGGGGG + Intergenic
1094474371 12:30830024-30830046 CTGGTCCAGAATTGGGTTGGAGG - Intergenic
1095201021 12:39384490-39384512 TTGTCCAAGAATGGGGGAGTGGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1097155787 12:57011373-57011395 CTTCCAAAGAATTGGGGTGGAGG - Intronic
1097174656 12:57135813-57135835 CAGGCCAAAAATGGGGGTGGGGG + Intronic
1097526419 12:60741549-60741571 CAGGAAAAGAATTGGGGAGAGGG - Intergenic
1097900997 12:64873771-64873793 CAGTCAAATAATTGGGGAGGTGG + Intronic
1097916781 12:65029399-65029421 ATTCCCAAGAATTGAGGAGGAGG - Intergenic
1098750832 12:74292334-74292356 CCGGCCACAAGTTGGGGAGGAGG - Intergenic
1100477686 12:94949191-94949213 ATGGGCAAGAACTGGGGATGAGG - Intronic
1101241954 12:102847941-102847963 CTGGAGAAGAATTAGTGAGGGGG + Intronic
1101473211 12:105018814-105018836 CTGGACAAGAATTTGGGTGCAGG - Intronic
1102262526 12:111453102-111453124 TTGGCTAATATTTGGGGAGGGGG - Intronic
1102375262 12:112416824-112416846 CTGGCCAGGATTTAGGGAGAGGG + Intronic
1102807780 12:115797030-115797052 CTGGCTAAGAATTGAGGACAGGG + Intergenic
1104336916 12:127906804-127906826 ATGACCCAGAATTTGGGAGGGGG + Intergenic
1104595030 12:130115104-130115126 CTGCCCAGGAATGAGGGAGGAGG - Intergenic
1106762403 13:32880111-32880133 CTGTCAGAGAATTGGGGATGAGG - Intergenic
1107410669 13:40155469-40155491 CTAGCTGAGAATTGGGGAGATGG + Intergenic
1110832113 13:80043599-80043621 ATGGCCAAGAGGTGGTGAGGGGG - Intergenic
1112108853 13:96272443-96272465 CTAAACAGGAATTGGGGAGGAGG - Intronic
1112360891 13:98717574-98717596 CCTGCCAAGAATTAGAGAGGAGG + Intronic
1117230000 14:53707530-53707552 CTGACCTAGATTTGGGGAGGAGG + Intergenic
1118055177 14:62072417-62072439 ATTGCAAAGAATTGGGAAGGTGG + Intronic
1118320505 14:64749605-64749627 CTGGCTAAGAAGGGGGTAGGTGG - Exonic
1121847416 14:97185347-97185369 CTGGCCAAGAAAAGGGCAGGTGG - Intergenic
1122170313 14:99868348-99868370 CTTCCAAAGAATTGAGGAGGAGG - Intronic
1122825227 14:104367478-104367500 CGGGACAAGAATTGGCCAGGGGG + Intergenic
1125200175 15:37095979-37096001 TTGAACAAGAATTGGGGAGAGGG - Intronic
1127389379 15:58492866-58492888 CTGGCCAAGAACAGGAGAGGGGG + Intronic
1127835083 15:62784094-62784116 CTGGCCAAGAACTGGGGCATGGG + Intronic
1127930965 15:63597327-63597349 CCGGCCCAGAGTCGGGGAGGAGG + Intergenic
1128186381 15:65646483-65646505 CTGGCCAGGGGCTGGGGAGGGGG - Intronic
1128251052 15:66164664-66164686 CTGGCCAAGAATTGGGATTGGGG - Intronic
1130004763 15:80084478-80084500 CTGGCCAAGAAGTGGGAGGGAGG + Intronic
1130350241 15:83085099-83085121 CTGGGCAGGAGTTGGGGAGACGG + Intergenic
1130634061 15:85599574-85599596 CTGTCCCAGAAGGGGGGAGGTGG + Intronic
1131095335 15:89651076-89651098 CTGGCCAAGCATGGTGGTGGGGG - Intronic
1131105690 15:89732782-89732804 CTGGAGAGGAATTGGGGAGGGGG - Intronic
1131435664 15:92419514-92419536 CTGGCCATGGTCTGGGGAGGGGG + Intronic
1131962405 15:97803547-97803569 CTGTCCATCAATTGGGGTGGAGG - Intergenic
1132411070 15:101578611-101578633 ATGACCCAGAAGTGGGGAGGGGG + Intergenic
1132411190 15:101579297-101579319 ATGATCAAGAAGTGGGGAGGGGG - Intergenic
1133094745 16:3435723-3435745 CTGGACTTGACTTGGGGAGGGGG - Exonic
1133114001 16:3565603-3565625 GGGGCCAAGGGTTGGGGAGGAGG + Intronic
1133913480 16:10086998-10087020 ATTACCATGAATTGGGGAGGAGG + Intronic
1135480525 16:22817289-22817311 CTGGTCAAGCAATGGGGAGAGGG - Intronic
1138092410 16:54186578-54186600 CTGGAAAAGAGGTGGGGAGGAGG + Intergenic
1139528255 16:67529294-67529316 CTGGGCTGGAAATGGGGAGGGGG + Intronic
1140598114 16:76440460-76440482 CTTGCCGATAATTGTGGAGGTGG - Intronic
1142990973 17:3730681-3730703 ATTGCCATGACTTGGGGAGGGGG - Intronic
1143654693 17:8287207-8287229 CCAGCCAAGAATTGGGCAAGAGG - Intergenic
1144087930 17:11827435-11827457 AAGACCAAGAGTTGGGGAGGAGG + Intronic
1144783497 17:17819505-17819527 CTGGCCAGGGGTTGGGGAGGGGG - Intronic
1146826417 17:36027217-36027239 GTTGCCAAGAATTGAGGAAGGGG - Intergenic
1147374968 17:40017850-40017872 CTGGCCAGGGGCTGGGGAGGTGG + Intergenic
1148083610 17:44980891-44980913 CTGCCCACGTTTTGGGGAGGGGG - Intergenic
1148757041 17:49978688-49978710 CAGGCCAGGAAATGGGGAAGTGG - Intergenic
1148829796 17:50424312-50424334 CTGGGTAAGAATTGAGTAGGTGG - Intergenic
1150225083 17:63520179-63520201 CTGGGCATGACTTGGGGTGGGGG - Intronic
1151344231 17:73491979-73492001 CTGGCCCAGATTTCGGGAGTGGG - Intronic
1151706475 17:75771515-75771537 CTGGCCAGGAAATGGGGGGAGGG - Intergenic
1151719153 17:75845825-75845847 CTGGCCATGAAGTGAGGAGATGG - Exonic
1151919018 17:77140398-77140420 CTCGCCGAGTAATGGGGAGGAGG - Intronic
1152181335 17:78823540-78823562 CTGGGCAAGAATGGAGGAGGGGG + Intronic
1152260333 17:79263282-79263304 CCGGCCCAGCATTGGGAAGGTGG + Intronic
1152898869 17:82928705-82928727 CTGGGGAAGAGATGGGGAGGGGG - Intronic
1153808842 18:8734209-8734231 ATTGCCACAAATTGGGGAGGGGG - Intronic
1154158427 18:11961287-11961309 CTGGATGAGAATTGGGGATGGGG + Intergenic
1154411080 18:14142681-14142703 CTGGGCTTGAAGTGGGGAGGAGG - Intergenic
1157472899 18:48003406-48003428 TTGGCAAAGACTTGGGGAGCTGG - Intergenic
1157568386 18:48696089-48696111 CTGGGGAAGAAGTGGAGAGGGGG - Intronic
1157914787 18:51654566-51654588 CCTGCCCAGAACTGGGGAGGTGG + Intergenic
1158300896 18:56051624-56051646 CTGTCAAAGAACTGGGGAGTAGG + Intergenic
1158319636 18:56248867-56248889 CTGCCCAAGACCTGGGGTGGGGG + Intergenic
1159907772 18:74113276-74113298 GTTGCCAGGAATTAGGGAGGAGG + Intronic
1160045093 18:75379206-75379228 CTGAACATGAATTGGGGAAGGGG + Intergenic
1160493451 18:79356721-79356743 GTGGCCAGGGATTAGGGAGGAGG + Intronic
1160822684 19:1065877-1065899 CTGGCCATAAAGTGGGGATGAGG + Intergenic
1160897207 19:1408357-1408379 CTGGCCAGGAAGCCGGGAGGCGG - Intronic
1160960798 19:1719933-1719955 GTGGCCATGTATTCGGGAGGAGG + Intergenic
1161680889 19:5679275-5679297 ATGGCCAGGAAGTGGGGAGAGGG + Intronic
1161809738 19:6464881-6464903 AGGGTCAAGAATTGGGGAGCGGG + Intronic
1163091310 19:15022039-15022061 CCTGCCACGAAGTGGGGAGGCGG + Intronic
1163264409 19:16209985-16210007 GTGGCCAGGAAATGGGGAAGAGG - Intronic
1163332080 19:16645962-16645984 ATGGTCAAGAATTGGGCAAGTGG - Exonic
1164648708 19:29876755-29876777 TTGGCCTAGAATTAGGGAGGGGG + Intergenic
1165108176 19:33486649-33486671 CTGGCCCTGATCTGGGGAGGTGG + Intronic
1165466347 19:35977270-35977292 CTGGACAATGAGTGGGGAGGGGG - Intergenic
1165660896 19:37579188-37579210 CTGGCTATGATGTGGGGAGGTGG - Intronic
1166271618 19:41717891-41717913 CTGACCAAGAATAGGAGGGGAGG + Intronic
1167156711 19:47743195-47743217 CTGGGCAGGATTTGGGGTGGGGG + Intergenic
1167358756 19:49019001-49019023 CTGAGCAAGATTGGGGGAGGAGG + Intergenic
1167366448 19:49057249-49057271 CTGAGCAAGATTGGGGGAGGAGG + Exonic
1167690044 19:50979758-50979780 CTGGGGAGGAATTGGGGGGGAGG + Intronic
1168161849 19:54515705-54515727 CTGGGCAGGTGTTGGGGAGGAGG + Intergenic
1168273510 19:55263339-55263361 CTGACCAAGATTTGGGGAGTTGG + Intronic
925697987 2:6602690-6602712 CAGCCCAATAGTTGGGGAGGGGG + Intergenic
927024033 2:19047215-19047237 CGAGCCAAAAATTGAGGAGGAGG + Intergenic
927201984 2:20583618-20583640 GTGGCAAAGGAGTGGGGAGGAGG + Intronic
927279208 2:21288828-21288850 CTAGGCAAGAATTGGGGACTAGG - Intergenic
928185764 2:29109237-29109259 TTGGCCAAAAATTTGGGGGGTGG + Intronic
928936201 2:36680848-36680870 GTTGCCAGGAATTAGGGAGGAGG - Intergenic
929350111 2:40940344-40940366 CTGACTAAGAATTGGGTAGATGG - Intergenic
931852164 2:66262616-66262638 CTGGCCTAGAATTGCTGAAGTGG + Intergenic
931980066 2:67685235-67685257 CAGGGCAAGCCTTGGGGAGGAGG - Intergenic
932230735 2:70082241-70082263 CTGGCCAAGTACTGTGGATGAGG - Intergenic
933727594 2:85435554-85435576 CTGGCCGAGCAGTGGGGAGCAGG + Intronic
934902989 2:98175878-98175900 GGAGCCAAGAAATGGGGAGGAGG - Intronic
938757248 2:134392071-134392093 CTGCCTGAGAAATGGGGAGGAGG + Intronic
944152628 2:196576538-196576560 GTTGCCAGGAATTGGGAAGGTGG + Intronic
944247843 2:197550101-197550123 CTGGCCTAGAACTGAGGAGCAGG + Intronic
944304987 2:198169105-198169127 GTGGCCATGAATTTGGGTGGGGG + Intronic
944905044 2:204253724-204253746 CTGGACAAGATTTGGGGTGAAGG - Intergenic
945510335 2:210693789-210693811 TATGCCAATAATTGGGGAGGTGG - Intergenic
946257195 2:218452327-218452349 TTTGCCCAGAATTGGGGATGGGG - Exonic
947461726 2:230309475-230309497 ATGGCCAAGAATATGGGATGTGG + Intronic
948677844 2:239609558-239609580 CTGCCTAAGAAGAGGGGAGGTGG - Intergenic
948880163 2:240852566-240852588 CTGGCCCAGAAGTGGGGACCTGG - Intergenic
948936842 2:241171068-241171090 CTGGCAAAAAATTAGGGAGCAGG + Intronic
1170645121 20:18190958-18190980 CTGGCTAAGCCTTGGGGAGGGGG + Intergenic
1173304339 20:41833859-41833881 CTGGCAAAGAATTTGGGATTGGG - Intergenic
1174512364 20:51063542-51063564 CTGGCCAAATCTTGGGGAAGTGG - Intergenic
1175371514 20:58495946-58495968 CAGGCCAAGGATGGGGGATGTGG - Intronic
1175536966 20:59721562-59721584 CAGGCCAGGAGTTGGGAAGGGGG + Intronic
1176861975 21:14015734-14015756 CTGGGCTTGAAGTGGGGAGGAGG + Intergenic
1177297173 21:19190704-19190726 CTGGGGATGAATTGGGGAAGGGG - Intergenic
1180110032 21:45643328-45643350 CGGGGCAAGAATCGGGGCGGGGG - Intergenic
1180131159 21:45828143-45828165 CTGGCCAAGACTTCAGGGGGTGG + Intronic
1181285187 22:21747037-21747059 CTGACCATCAGTTGGGGAGGAGG + Intergenic
1183272102 22:36868633-36868655 CTGGGCTAGAATAGGGGAGTGGG + Intronic
1183805569 22:40207704-40207726 ATGGCCAATAAATGTGGAGGGGG + Intronic
1184039221 22:41933407-41933429 CTGGCCAAGCATATTGGAGGAGG + Intergenic
1184098359 22:42328818-42328840 CTGGCTAAGACCTGGGGTGGGGG - Intronic
1185236363 22:49715809-49715831 CTCTCCAAGACTTGGGGATGAGG - Intergenic
1185273330 22:49938467-49938489 CGGGCCAGGAACCGGGGAGGCGG + Intergenic
949508424 3:4747615-4747637 CTGCCCATGAATTCTGGAGGAGG + Intronic
949743017 3:7258216-7258238 CTAGCCAAGAAATGGGGCAGTGG - Intronic
949888000 3:8711658-8711680 GTGTCCAGGAATTGGGGGGGTGG + Intronic
950138986 3:10602123-10602145 CAGGGCAGGAAGTGGGGAGGGGG - Intronic
950557077 3:13702433-13702455 CTGGCCTACCATTGGGGTGGGGG + Intergenic
950898236 3:16473220-16473242 CTGGCCCAGTATTGGGGTGGAGG - Intronic
952610501 3:35203250-35203272 GTGGACAAGAATTTGGGTGGGGG - Intergenic
954368125 3:50156742-50156764 CAGGCCCGGAAGTGGGGAGGTGG + Intronic
954574059 3:51665175-51665197 CTGGCAAAGTGTTGGGGTGGGGG - Exonic
954635368 3:52068236-52068258 CTGGCCCAGGCTTGGGGAGGGGG - Intergenic
954654677 3:52186621-52186643 CTGGCGATGATTTGGGGTGGAGG - Intergenic
954760145 3:52867962-52867984 CTGGTCAAGAATTGTGGAGAGGG - Intronic
958645899 3:96873304-96873326 CTGCCCCAGAATTGGAGAGATGG - Intronic
959303107 3:104627739-104627761 GTGGCAAACAATTGAGGAGGGGG + Intergenic
959689194 3:109180253-109180275 CTGACCAAGAATGAGGGTGGAGG - Intergenic
959945750 3:112123881-112123903 ATGGCCAAGAGATGGGGAGGAGG - Intronic
959950379 3:112174621-112174643 CTGGTGAAGAGTTGGGGTGGTGG + Intronic
960785804 3:121372010-121372032 CTGGCAAAGCAATGTGGAGGTGG + Intronic
961758618 3:129147785-129147807 GTGGCCAAAAGTTGGGTAGGGGG - Intronic
964477930 3:157113177-157113199 CTAGCCTAGAGTTGGGGTGGGGG - Intergenic
966874617 3:184315015-184315037 CTGGCCGCGAAGGGGGGAGGGGG - Intronic
966945582 3:184775084-184775106 CGGGCCAAGAACTGGGGACCAGG + Intergenic
968952704 4:3702956-3702978 CTTGCCAAGCACGGGGGAGGGGG - Intergenic
970306528 4:14738217-14738239 GAGGCAAAGAAATGGGGAGGTGG - Intergenic
970309313 4:14765687-14765709 CTGGACAAGATTTGGGGCTGTGG + Intergenic
970490534 4:16569097-16569119 CTGTTCAAGAATTTGGTAGGTGG + Intronic
972413459 4:38815703-38815725 ATAGCCAAGAAATGGGGAGGTGG - Intronic
973268516 4:48235580-48235602 CTGGACCAAAATGGGGGAGGAGG + Intronic
975373410 4:73614054-73614076 ATGGGAAAGAATTGTGGAGGAGG - Intronic
975651563 4:76598596-76598618 GTGGCCAGGAAGTGGGGAGCAGG + Intronic
976673820 4:87682812-87682834 ATGGGCAAGAATTGAGTAGGAGG - Intergenic
979799955 4:124896060-124896082 CTTGCCAAGAAGTGGAGAAGGGG + Intergenic
982574285 4:157089244-157089266 TTAGCCAAGCATGGGGGAGGGGG + Intronic
983516034 4:168657735-168657757 CTGGCAAAGAAAAGGGAAGGTGG - Intronic
984149449 4:176108400-176108422 GTTGCCAGGAATTGGGGAGGGGG + Intronic
984394736 4:179181767-179181789 CTGGTAAAGAACTGGAGAGGAGG + Intergenic
985552614 5:541213-541235 CTGGCCTGGGGTTGGGGAGGGGG + Intergenic
987044556 5:14094907-14094929 CTGGCCAGGAAATGTGGAAGGGG - Intergenic
989110378 5:37901745-37901767 CTGGCAAAGGAGTGGGGAGGAGG + Intergenic
991389544 5:66127459-66127481 CATGCCAAGAACTGGGGAGTGGG + Intergenic
991967300 5:72106258-72106280 CTGTCCCAGAAAAGGGGAGGAGG - Intergenic
992003162 5:72454529-72454551 CTGGACCAGAATTGATGAGGTGG + Intronic
992869498 5:80992082-80992104 CTGGTCCAGGATAGGGGAGGAGG - Intronic
993794369 5:92248935-92248957 CTGGCCATGGAGTGGGCAGGTGG - Intergenic
995284939 5:110377488-110377510 GTGGTTAGGAATTGGGGAGGAGG - Intronic
995775020 5:115715835-115715857 CTTGCCCAGATTAGGGGAGGGGG + Intergenic
997436601 5:133880193-133880215 CTGGCCAAGCTTTGGGGCAGTGG - Intergenic
997733593 5:136197768-136197790 CTGGCCAAGTACTGGCAAGGAGG + Intergenic
999427430 5:151500042-151500064 GGGGCCCAGATTTGGGGAGGTGG - Intergenic
1001322340 5:170693122-170693144 CCAGCCCAGAATTGGGGATGTGG + Intronic
1001450498 5:171820801-171820823 CGGGCCAGGAGTGGGGGAGGGGG + Intergenic
1001745805 5:174091364-174091386 CAGGCCAAGAGCTGGGCAGGCGG + Intronic
1003481999 6:6543035-6543057 CTAGGCAAGAACAGGGGAGGAGG - Intergenic
1006136939 6:31901390-31901412 CTGGGCAAGAATGGGGGCGAGGG - Intronic
1007267323 6:40606690-40606712 CTGGGCAAAAATTGGGAAGTTGG - Intergenic
1007465515 6:42048720-42048742 CTGGGCAGGAAGTGGGGAAGAGG + Intronic
1007495512 6:42257771-42257793 CTGGCCAAGAATTGGGGAGGAGG + Intronic
1013540570 6:111104118-111104140 CTGGCAAAGAATGGTGGAGCTGG + Intronic
1014031787 6:116714413-116714435 CTGACTAAGAATTGAAGAGGTGG - Intronic
1014137610 6:117907443-117907465 CGGGCCAGGACTTGGGGACGCGG + Intergenic
1014567239 6:122964557-122964579 GTGGCCAGGAATTAGGGAGTGGG + Intergenic
1015210817 6:130696266-130696288 CTGGCCAAGATTTTGGGTTGGGG - Intergenic
1016157833 6:140834950-140834972 CTGGCCAAGATTTTGTTAGGTGG - Intergenic
1017133992 6:151132372-151132394 CTGGCCAAGAAATGACCAGGAGG + Intergenic
1019444106 7:1062004-1062026 CTGGGGAAGAATTGGGGAGTTGG - Intronic
1019758014 7:2787697-2787719 CTGGCCAGGCATCGGGAAGGGGG + Intronic
1021736667 7:23645975-23645997 CTGAACAGGAATTGGGAAGGAGG - Intergenic
1021913349 7:25408012-25408034 CTGGCCAAGTGATGGGGAGTGGG - Intergenic
1022501971 7:30887476-30887498 CTGGGCATGCGTTGGGGAGGAGG + Intronic
1023256655 7:38319033-38319055 CAGGCCAAGACTTGGGTAGGAGG - Intergenic
1023831169 7:44039733-44039755 GTAGCAAAGACTTGGGGAGGGGG - Intergenic
1026847314 7:73705375-73705397 CTGGCCCAGAATTGGGGGAGGGG - Intronic
1028160222 7:87476142-87476164 CTGGACCAGAACTGGGGATGCGG - Intronic
1028279185 7:88899030-88899052 CTCACCAAAAATTGGGGATGGGG - Intronic
1029352985 7:100028634-100028656 CTTGGCAAGAGATGGGGAGGGGG + Intronic
1029741497 7:102494039-102494061 GTAGCAAAGACTTGGGGAGGGGG - Intronic
1029759489 7:102593208-102593230 GTAGCAAAGACTTGGGGAGGGGG - Intronic
1029776856 7:102689118-102689140 GTAGCAAAGACTTGGGGAGGGGG - Intergenic
1032189322 7:129754544-129754566 CTGGGGAAGGGTTGGGGAGGGGG + Intronic
1032222697 7:130006589-130006611 CGGGCACTGAATTGGGGAGGGGG + Intergenic
1032753190 7:134863172-134863194 GTGGGCAGGAGTTGGGGAGGGGG + Intronic
1033038757 7:137899378-137899400 CTGGCCAAGAATTGGCGAAAAGG - Intronic
1034285792 7:149882210-149882232 TTGGCCCAGGATTGGGGTGGGGG + Intergenic
1034335896 7:150323387-150323409 CTGGCCAACAAGTTGGGTGGTGG + Exonic
1036441519 8:8785852-8785874 CTGGGGAAGAGGTGGGGAGGGGG - Exonic
1038930810 8:32191674-32191696 CTGGACAGGAAATGGGGATGGGG + Intronic
1039079810 8:33723046-33723068 CCGGCCACGAGGTGGGGAGGAGG + Intergenic
1039616464 8:38958488-38958510 CTGCCCAAGAAATGGGAAAGCGG - Intronic
1041486685 8:58385155-58385177 GTTGCCAAGGATTGGGGATGGGG - Intergenic
1042370397 8:67984907-67984929 CTTGCCAAGGAAAGGGGAGGTGG - Intronic
1043396065 8:79838362-79838384 GTTGCCAGGAATTAGGGAGGAGG + Intergenic
1044569988 8:93706486-93706508 GTGGCCTGGAGTTGGGGAGGTGG + Intronic
1047920202 8:129627891-129627913 ATAGCAAAGAATTGGGGTGGGGG - Intergenic
1052331554 9:27275037-27275059 ATATACAAGAATTGGGGAGGGGG + Intergenic
1052748306 9:32463161-32463183 GGGGCCAAGAAGTGGGGAAGGGG - Intronic
1053598646 9:39588231-39588253 CTGGCCTAGAGCTGGGGTGGTGG + Intergenic
1055070643 9:72162530-72162552 GTGGCAAAGAATGGAGGAGGAGG + Intronic
1055637082 9:78289571-78289593 CTGCCCAAGGATTTGGGTGGAGG - Intergenic
1057999199 9:99848192-99848214 CTAGCCAAGAACTGGGGACAGGG - Intronic
1060982551 9:127802303-127802325 GAGGCCCAGAACTGGGGAGGAGG - Intronic
1061201658 9:129141732-129141754 CTGGCCAGGAGGTGGGGAAGGGG - Intronic
1061261816 9:129484310-129484332 GTGGCCAAGAACTGGCAAGGTGG - Intergenic
1061420029 9:130468187-130468209 CTGGCTCAGAATTTTGGAGGAGG - Intronic
1186444557 X:9615726-9615748 CTGGCCAAGGATGGGAAAGGGGG - Intronic
1189245739 X:39561859-39561881 GTCTCCAAGGATTGGGGAGGAGG + Intergenic
1190249077 X:48708582-48708604 CAGGCCAAGAATTGGGGGTGGGG + Exonic
1196041231 X:111206383-111206405 CTTGCTAAGAATTGCAGAGGGGG - Intronic
1196316331 X:114229192-114229214 CTGGCCAAGGAGGAGGGAGGAGG - Intergenic
1196753135 X:119135464-119135486 CTGTTCCAGCATTGGGGAGGAGG + Intronic
1198227564 X:134659518-134659540 CTGGCCCATAAGTGGGGATGGGG + Intronic
1200208143 X:154332628-154332650 CTGGCCCAGAAGCGGGCAGGCGG - Intergenic
1200818755 Y:7560788-7560810 CTGGCCCAGAAATGGGGATGAGG - Intergenic