ID: 1007497662

View in Genome Browser
Species Human (GRCh38)
Location 6:42271975-42271997
Sequence TGCGTTTTTAAAATGGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007497658_1007497662 18 Left 1007497658 6:42271934-42271956 CCAGAAGAAAAAGGAACACTGAC 0: 1
1: 0
2: 3
3: 42
4: 347
Right 1007497662 6:42271975-42271997 TGCGTTTTTAAAATGGATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007497662 Original CRISPR TGCGTTTTTAAAATGGATGA CGG Intronic
No off target data available for this crispr