ID: 1007498090

View in Genome Browser
Species Human (GRCh38)
Location 6:42275521-42275543
Sequence TGTCCCTACATCACAGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007498090_1007498098 11 Left 1007498090 6:42275521-42275543 CCAGTCACTGTGATGTAGGGACA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1007498098 6:42275555-42275577 ATGTGGTGTCCTCAGGGACTGGG 0: 1
1: 0
2: 1
3: 12
4: 205
1007498090_1007498097 10 Left 1007498090 6:42275521-42275543 CCAGTCACTGTGATGTAGGGACA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1007498097 6:42275554-42275576 CATGTGGTGTCCTCAGGGACTGG 0: 1
1: 0
2: 0
3: 14
4: 168
1007498090_1007498093 4 Left 1007498090 6:42275521-42275543 CCAGTCACTGTGATGTAGGGACA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1007498093 6:42275548-42275570 CCTGCCCATGTGGTGTCCTCAGG 0: 1
1: 0
2: 1
3: 25
4: 213
1007498090_1007498091 -6 Left 1007498090 6:42275521-42275543 CCAGTCACTGTGATGTAGGGACA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1007498091 6:42275538-42275560 GGGACAGCAGCCTGCCCATGTGG No data
1007498090_1007498094 5 Left 1007498090 6:42275521-42275543 CCAGTCACTGTGATGTAGGGACA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1007498094 6:42275549-42275571 CTGCCCATGTGGTGTCCTCAGGG 0: 1
1: 0
2: 2
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007498090 Original CRISPR TGTCCCTACATCACAGTGAC TGG (reversed) Intronic
901310299 1:8264315-8264337 TGTCCCCACATTACAGAGAAGGG - Intergenic
908438906 1:64133667-64133689 TGGCCATTCATCACAGTGGCTGG - Intronic
911096039 1:94055885-94055907 TGACTCTACAGCACAGAGACAGG + Intronic
920511597 1:206556200-206556222 GGTCTGTACATGACAGTGACTGG + Intronic
923329146 1:232906610-232906632 TGTCCCTTCCTCACAGTGTCAGG + Intergenic
923368235 1:233284873-233284895 TGTCCCTCAACCATAGTGACTGG + Intronic
923821926 1:237454280-237454302 TCTCCCTACATCACTGTAAAAGG - Intronic
1065969789 10:30797261-30797283 TGTCCCTACAACTCACTCACAGG + Intergenic
1066230147 10:33424234-33424256 TGTCTCTGCTTCACAGTGTCTGG - Intergenic
1067900619 10:50237247-50237269 TGTCCTTGCATCACAGTGGATGG - Intronic
1070652580 10:78248483-78248505 TGCCCCTAAAACACAGTGCCTGG - Intergenic
1070960718 10:80498380-80498402 TGTCCCTAACTCACAGAGTCAGG - Intronic
1073293107 10:102423036-102423058 TTTCCCTACAGCTCAGTGTCAGG - Exonic
1074282922 10:112070094-112070116 AGTCCCTACACCCCAGAGACTGG + Intergenic
1075999494 10:126904223-126904245 TGTCCCTACCTCACAGAGGTAGG + Intergenic
1078556743 11:12333662-12333684 TGGACCTAAATAACAGTGACTGG + Intronic
1081478832 11:43464408-43464430 TTTCCCTACATCCAAGTTACAGG - Intronic
1081517438 11:43846789-43846811 TGTGCCTTCAGCACAGGGACTGG - Intronic
1083163687 11:60870899-60870921 TGTCCATCCAGCACAGAGACGGG - Intronic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1090442451 11:126735655-126735677 TGTCCCTAAACCAGAGTTACAGG - Intronic
1094163749 12:27420675-27420697 TTTCCCCACATCCCTGTGACAGG - Exonic
1094321283 12:29186378-29186400 TGTCTCTATGACACAGTGACAGG - Intronic
1096573347 12:52537432-52537454 GGTGCCTACATCACAGAGAGGGG + Intergenic
1097959889 12:65522210-65522232 TGTCCCTGCTCCACATTGACTGG + Intergenic
1098037821 12:66323381-66323403 TGGCCCATCATCACAGTTACTGG - Intronic
1099095987 12:78375110-78375132 AGTGCATACATCTCAGTGACAGG + Intergenic
1100358502 12:93854637-93854659 TGTCCTTGAATCACAGTAACAGG + Intronic
1111877264 13:93912855-93912877 AGTCCCTACCTGCCAGTGACTGG + Intronic
1113646997 13:112005146-112005168 AATTCCTACATCACAGTGGCAGG + Intergenic
1113926741 13:113945969-113945991 GGACCCTAAATCACAGTGAACGG - Intergenic
1117029471 14:51652777-51652799 TGTCCATACCTGACAGTGCCTGG - Intronic
1117683436 14:58228629-58228651 TTTGCCTACATCTCATTGACTGG + Intronic
1118045082 14:61960809-61960831 TGTCCCAACATCATACTGAATGG - Intergenic
1120287757 14:82526199-82526221 TGTAACTACATCATAGTGAGTGG - Intergenic
1121687907 14:95852862-95852884 TCTACCTACATCTCACTGACTGG + Intergenic
1122961894 14:105097775-105097797 TGGCCCTACAGCTCAGTCACAGG - Intergenic
1124804910 15:32871838-32871860 AGTCCCTACATGACAGTGACAGG - Intronic
1125731227 15:41893770-41893792 GGTCCCTCCACCACAGTGACTGG + Intronic
1126222503 15:46230598-46230620 TGTCTCTGCTTCACAGTGACTGG + Intergenic
1126311652 15:47323715-47323737 CGTCTCTTTATCACAGTGACAGG - Intronic
1127295151 15:57602457-57602479 TGGCCCTAAATCAAAATGACTGG - Intronic
1127349685 15:58138190-58138212 TGTTGCCAAATCACAGTGACGGG - Exonic
1137273300 16:46917193-46917215 AACCCCTACATCACAGTGATTGG - Intronic
1142176625 16:88648225-88648247 CATCCCCACAGCACAGTGACAGG + Intronic
1144752388 17:17658129-17658151 TGTCCCTACAGCAGTGTCACTGG + Intergenic
1146465724 17:33084651-33084673 TGTCCCTACAGCATAATGCCTGG + Intronic
1149206729 17:54256480-54256502 TGTCTCTACTCCACTGTGACTGG + Intergenic
1150423474 17:65057877-65057899 AGAGCCTACATCACAGTGTCCGG - Intergenic
1150699576 17:67435448-67435470 TGTCCCTGCATCCCAGGGCCTGG - Intronic
1151882286 17:76902959-76902981 GCTCCCCACATCACAGGGACTGG - Intronic
1152905149 17:82965906-82965928 TGTCCCTTCTCCACAGGGACGGG + Intronic
1154466075 18:14643405-14643427 TGTCTCTGCAACACAGTGAGAGG - Intergenic
1161630774 19:5354364-5354386 TGTTCAAACATCACAGTGATGGG - Intergenic
1162873008 19:13600030-13600052 TCTCCCTCCAGCACAGTGAGGGG + Intronic
1164821356 19:31253813-31253835 TGTCCCTTCAGCAAAGGGACAGG + Intergenic
1166563904 19:43751697-43751719 TGCCCCTTCCTCCCAGTGACAGG + Intronic
1166867403 19:45848231-45848253 TGTGCCTTCATCACACTGAGTGG - Intronic
925278933 2:2669580-2669602 TGACCCTTCATCAGCGTGACTGG + Intergenic
927651740 2:24917643-24917665 AGACCCTACGTCACAGTGGCCGG + Intronic
928228130 2:29472279-29472301 TGCCCCTGCTTCACAATGACTGG - Intronic
929066593 2:37982120-37982142 TGCCCCTACATCATAGGGATGGG - Intronic
929484015 2:42338948-42338970 TGTCCCTGCATCAGAGCGCCAGG + Intronic
930145964 2:48004626-48004648 TGTAGCTACATCACAGGGAAAGG - Intergenic
932076111 2:68664406-68664428 TGTGCTTCCATCACAGTGAGGGG + Intergenic
932656409 2:73614456-73614478 TTTCCCCACATCACAGTGAAGGG - Intergenic
932763322 2:74454907-74454929 TGTCCCGACCTCAGAGGGACCGG + Intergenic
933123879 2:78578238-78578260 TGTATCTACAACACAGTGCCTGG - Intergenic
935950079 2:108320689-108320711 TGCCTCTCCAACACAGTGACAGG + Intergenic
936256801 2:110923035-110923057 TCTCCCTACATCACAGTAGGGGG + Intronic
943998569 2:194802999-194803021 TGTCTTAACATCACACTGACTGG + Intergenic
944108791 2:196108598-196108620 TATCCCAACTTCACAGTTACAGG - Intergenic
945180816 2:207089121-207089143 TGTCCATCCATCACATTTACTGG - Intronic
946492433 2:220162335-220162357 TTTTACTACATCTCAGTGACAGG - Intergenic
946732664 2:222724223-222724245 TGTGCCTACATCACTAGGACAGG - Intergenic
948292067 2:236832961-236832983 TGTCTCTAGAACCCAGTGACTGG - Intergenic
1176808510 21:13515191-13515213 TGTCTCTGCAACACAGTGAGAGG + Intergenic
1177723195 21:24934024-24934046 TACCCATACATCACAATGACAGG - Intergenic
1180840804 22:18958045-18958067 GGTGCCCACATCACAGAGACTGG + Intergenic
1184304661 22:43589110-43589132 TGTCCCTACTTCTAAGTGACAGG - Intronic
949840411 3:8313942-8313964 TTTCTCTACCTCACAGTCACCGG + Intergenic
950911599 3:16600769-16600791 TGTCTCTGCATCACAGTGTTTGG + Intronic
954637797 3:52080846-52080868 TCTCCCTAAATCGGAGTGACAGG + Intronic
955804152 3:62716670-62716692 TGTCCTTACATCACATTTATGGG + Intronic
959178801 3:102952420-102952442 TGTCCCCACATCAGCATGACAGG + Intergenic
962006633 3:131356299-131356321 TGTTCTTACAACACAGTGGCTGG - Intergenic
965407805 3:168292478-168292500 TGTCTCAAGATTACAGTGACTGG + Intergenic
968428580 4:538990-539012 TGTCCCAGCACCATAGTGACTGG + Intronic
973687740 4:53390274-53390296 TGACCGTACATCACAGAGACTGG + Intronic
978202307 4:106036334-106036356 AGTAGCTACATCACAGAGACAGG + Intergenic
980534882 4:134105097-134105119 TGTCAATGAATCACAGTGACAGG + Intergenic
982311238 4:153987479-153987501 TGTCCATACATAACAATGAGGGG + Intergenic
985572671 5:658100-658122 TGTCCCTACATCTCTGCCACAGG - Intronic
989414088 5:41153137-41153159 TGTCTTTACCTCACAGTGTCGGG + Intronic
991180955 5:63750426-63750448 TGTTCCTATATAATAGTGACAGG - Intergenic
992164756 5:74038491-74038513 TGTCCTCACATGGCAGTGACAGG - Intergenic
992298290 5:75349775-75349797 TGTCCCCATATCACAATGCCAGG - Intronic
993013153 5:82506912-82506934 GTTCCCTACAGCACAGTGGCTGG + Intergenic
994815503 5:104581730-104581752 TTTCCCTACATCAGGGTGAGAGG - Intergenic
998739735 5:145187026-145187048 TGTCTCTCCAGCACAGTGTCTGG + Intergenic
1000683689 5:164220101-164220123 TGTCCCTAAATCAGAGTATCTGG - Intergenic
1001884807 5:175279880-175279902 TGTCCCTTCATCTGAGTGAAAGG + Intergenic
1002177833 5:177411784-177411806 TGTCCTCACAACACAGTGGCTGG - Intronic
1004428892 6:15525546-15525568 TGTTCATACACCACAGTCACAGG + Intronic
1006512637 6:34529914-34529936 CAGCCCTCCATCACAGTGACGGG + Intronic
1007498090 6:42275521-42275543 TGTCCCTACATCACAGTGACTGG - Intronic
1010163032 6:72881074-72881096 TGTCACTACATTACAGAAACAGG + Intronic
1012544131 6:100397018-100397040 TGTCCCTACATCTCAGTTATTGG + Intronic
1012802023 6:103842728-103842750 TTTCCCTACATCACCCTGACAGG + Intergenic
1013493192 6:110670473-110670495 TGTTCCTTTCTCACAGTGACAGG - Exonic
1013753774 6:113437312-113437334 TGTCCTTACAACATAGTGATTGG + Intergenic
1014591762 6:123281434-123281456 TGTCCCTAAATCACATTTATTGG - Intronic
1017218240 6:151935487-151935509 TGTCCAGACTTCACAGTCACAGG + Intronic
1018174763 6:161168897-161168919 TGTCCCTACTTTACAGAGAAGGG - Intronic
1020175042 7:5875501-5875523 TGTCACTACATCACCCTGGCTGG + Intergenic
1027136405 7:75627454-75627476 TGTTCCTAGATCAAAGTGAGGGG + Intronic
1030656873 7:112178138-112178160 TTTTCCTTCATCACAGTTACAGG + Intronic
1038426395 8:27466982-27467004 TGTCCCTCTAGCACAGTGCCAGG + Intronic
1038940995 8:32305682-32305704 TGTCCCTACAAAAAGGTGACTGG - Intronic
1039422015 8:37451091-37451113 TGTCTCTGCATCACAGTGGGAGG - Intergenic
1045816127 8:106278667-106278689 TTTGCGTAGATCACAGTGACTGG + Intronic
1047256219 8:123215379-123215401 TGACCCTACAGCACAGGGCCAGG + Intergenic
1047511822 8:125521459-125521481 TTTCCCTATTTCACAGTCACAGG + Intergenic
1049745671 8:144262267-144262289 TGTCCCTTCAGCACCTTGACGGG + Exonic
1050616316 9:7404990-7405012 TTTGCCTTCATCACACTGACTGG + Intergenic
1052774990 9:32724210-32724232 TGTCCCTGCTCCACAGTGTCTGG + Intergenic
1053277864 9:36797001-36797023 TCTCCCTCTGTCACAGTGACTGG - Intergenic
1053372154 9:37571479-37571501 TGACACCACATCTCAGTGACAGG - Intronic
1055495218 9:76847590-76847612 TTTCTCTACACCACGGTGACTGG - Intronic
1056372699 9:85973229-85973251 TGGCCCTACATCACATGGCCCGG - Intronic
1056821531 9:89845541-89845563 TGTCCCTACAACACTGTTGCAGG + Intergenic
1059327983 9:113516180-113516202 TGTGCCTACTGGACAGTGACAGG - Intronic
1059923055 9:119179185-119179207 TCTCCCTGCCTCACACTGACTGG - Intronic
1189305386 X:39983149-39983171 TCCCCCAACAGCACAGTGACTGG + Intergenic
1199912928 X:152307522-152307544 TCTCCCTACATCATATTGGCTGG - Intronic
1200153898 X:153965105-153965127 TGTCCCTTCATCACAGGGTCAGG + Intronic