ID: 1007498574

View in Genome Browser
Species Human (GRCh38)
Location 6:42278981-42279003
Sequence CCTTCTATGCCAGGGCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007498567_1007498574 20 Left 1007498567 6:42278938-42278960 CCTGTCATCCTTTACAGTCTTTT 0: 1
1: 0
2: 1
3: 21
4: 266
Right 1007498574 6:42278981-42279003 CCTTCTATGCCAGGGCTGCTAGG 0: 1
1: 0
2: 2
3: 22
4: 232
1007498568_1007498574 12 Left 1007498568 6:42278946-42278968 CCTTTACAGTCTTTTATACCAAC 0: 1
1: 0
2: 0
3: 19
4: 163
Right 1007498574 6:42278981-42279003 CCTTCTATGCCAGGGCTGCTAGG 0: 1
1: 0
2: 2
3: 22
4: 232
1007498570_1007498574 -6 Left 1007498570 6:42278964-42278986 CCAACTCGCACTGAGGACCTTCT 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1007498574 6:42278981-42279003 CCTTCTATGCCAGGGCTGCTAGG 0: 1
1: 0
2: 2
3: 22
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007498574 Original CRISPR CCTTCTATGCCAGGGCTGCT AGG Intronic
900628744 1:3622663-3622685 CTTGCTCTGCCAGGCCTGCTTGG - Intergenic
902217159 1:14941518-14941540 TCTTCTAGGCCAGGGCAGCCTGG + Intronic
902245929 1:15120372-15120394 CCCTCAATGCCAGGGCTGCCTGG - Intergenic
903181973 1:21609457-21609479 CATTGTATGCCAGGGCAGCTGGG - Intronic
903413705 1:23167870-23167892 CCTTCCCTGCCCGGGCGGCTGGG + Intronic
904763303 1:32820890-32820912 CCTTGAACCCCAGGGCTGCTGGG - Intronic
905007838 1:34725363-34725385 ACTTCTGTGCCACTGCTGCTTGG - Intronic
907665764 1:56432768-56432790 CCTGCCCTGCCAGGGCTGTTTGG + Intergenic
910803264 1:91165726-91165748 CCTTCTCTCCCAGGGTTGGTGGG + Intergenic
911237014 1:95422464-95422486 CCCATGATGCCAGGGCTGCTGGG + Intergenic
919642155 1:200056048-200056070 CCTTCTGTTTCAGGTCTGCTTGG - Intronic
920174404 1:204091185-204091207 CCTTCCCTGCCAGGGCTAGTGGG + Intronic
920875178 1:209828158-209828180 CCTTCTATGACAGGTCTGAAGGG + Exonic
921269800 1:213457328-213457350 GATTCCATGCCAGGGCTGATTGG + Intergenic
922665311 1:227464146-227464168 CCTTCTGTGCCTGTCCTGCTTGG - Intergenic
922665363 1:227464455-227464477 CTTTCTGTGCCAGCCCTGCTTGG - Intergenic
922722259 1:227905045-227905067 CCTTCTGTCCAGGGGCTGCTGGG - Intergenic
923602659 1:235417235-235417257 CCTTCTTTGCCAGGTCAACTTGG - Intronic
1065771948 10:29085997-29086019 GCTTCTTTGTCAGTGCTGCTGGG - Intergenic
1065879493 10:30026884-30026906 CCTTGCAAGCCAGGGCTGCAAGG - Exonic
1067371788 10:45690911-45690933 CTCTGTGTGCCAGGGCTGCTAGG - Intergenic
1067418128 10:46122042-46122064 CTCTGTGTGCCAGGGCTGCTAGG - Intergenic
1067446272 10:46349363-46349385 CTCTGTGTGCCAGGGCTGCTAGG - Intergenic
1067503487 10:46828605-46828627 CTCTGTGTGCCAGGGCTGCTAGG - Intergenic
1067591106 10:47511408-47511430 CTCTGTGTGCCAGGGCTGCTAGG + Intronic
1067638225 10:48019500-48019522 CTCTGTGTGCCAGGGCTGCTAGG + Intergenic
1067685037 10:48461613-48461635 CCTTCTTTGCCTGGGCTGCCAGG - Intronic
1067762612 10:49059335-49059357 CCTTCTCTGCCAGCCATGCTGGG - Intronic
1067818794 10:49507866-49507888 ACCTATATGCCAGGGCTTCTTGG - Intronic
1067875270 10:50000861-50000883 CTCTGTGTGCCAGGGCTGCTAGG - Intronic
1070134829 10:73683926-73683948 CTCTGTGTGCCAGGGCTGCTAGG + Intronic
1070735245 10:78859541-78859563 CCTTCCAGCCCAGGGATGCTGGG + Intergenic
1074392292 10:113068512-113068534 CCTGCCATGCCATGGCAGCTGGG + Intronic
1074702076 10:116101206-116101228 GCTTCCCTGCCTGGGCTGCTGGG + Intronic
1074875937 10:117613468-117613490 CCTTCTCTGCCAGGGATGGATGG - Intergenic
1077049246 11:559361-559383 CCTTCCCTCCCAGGCCTGCTTGG - Intronic
1077169812 11:1161096-1161118 CTGCCTCTGCCAGGGCTGCTGGG - Intronic
1077599603 11:3565098-3565120 GCTTCTCTCCCAGGACTGCTAGG - Intergenic
1078369552 11:10733618-10733640 GCTTCCAAGCCAGGGCTTCTTGG - Intergenic
1078811671 11:14774142-14774164 CCTTTTATGCCCTGGCTGTTTGG + Intronic
1081564335 11:44248215-44248237 CTCTCTGTGCCAGGGCTGCTTGG - Intergenic
1082580093 11:54855646-54855668 CCTTCTCTGCCTTGGCTGCCAGG + Intergenic
1082793917 11:57366433-57366455 CCTTCTCTGCCTTGGCTTCTGGG - Intronic
1083163821 11:60871532-60871554 CCTTCCATGCCTGGCCTGCAGGG + Intronic
1083185730 11:61016804-61016826 CCTGCTAACCCAGGGCTTCTGGG + Intronic
1083424368 11:62575504-62575526 CCCGCTCTGCCAGGGCTGCGTGG + Exonic
1084255509 11:67939703-67939725 GCTTCTCTCCCAGGACTGCTAGG - Intergenic
1084421130 11:69061198-69061220 CCACCTCTGCCAGGGCTGCCGGG - Intronic
1084959430 11:72708685-72708707 CCTTCTAGCCCAGGCCTGGTGGG - Intronic
1086461926 11:87014613-87014635 CCTTGGATGCCTGGGCTGTTAGG - Intergenic
1087202411 11:95359215-95359237 CCTTCACTGCCAGGGCAGCGGGG + Intergenic
1088448060 11:109953481-109953503 CCTTCTATGCAAGGGCCCATAGG - Intergenic
1088683031 11:112260652-112260674 GTTTATATGCCAGGGCTTCTGGG + Exonic
1088724310 11:112620849-112620871 GCTTCTATGCCAGTGGTGCTGGG - Intergenic
1090448935 11:126789150-126789172 AACTGTATGCCAGGGCTGCTAGG - Intronic
1091318527 11:134632989-134633011 CCTTCTCTAGCAGGGATGCTGGG + Intergenic
1092331510 12:7590458-7590480 CCTTCTCAGACAGGGCAGCTGGG + Intergenic
1092425745 12:8374437-8374459 GCTTCTCTCCCAGGACTGCTAGG - Intergenic
1096552742 12:52384139-52384161 CATTCTCTGCCAGGGATGCCTGG - Intronic
1096936142 12:55279310-55279332 CCTTCTATGCCTAGCTTGCTTGG - Intergenic
1099382391 12:81970870-81970892 CCTTCTATGCCAGTTTTGCTGGG + Intergenic
1104785523 12:131445871-131445893 GCCTCTGTGTCAGGGCTGCTTGG - Intergenic
1105045899 12:133002942-133002964 CCTAACATGCCAGGGGTGCTAGG - Intronic
1105465721 13:20637809-20637831 CCATCTGTGCCAGGTCAGCTTGG - Intronic
1106115759 13:26816245-26816267 ATTTCTATGTCAGTGCTGCTGGG + Intergenic
1108924103 13:55716707-55716729 CCTTCTATGCCAATTTTGCTAGG + Intergenic
1112833953 13:103490837-103490859 TCTTTTATCCCAGGGCTCCTGGG - Intergenic
1114208936 14:20599381-20599403 CCATCTATGCAAGGCCTGGTAGG - Intronic
1114469093 14:22946708-22946730 CCTTCTCTGCCCGGGCTCTTAGG - Exonic
1118906431 14:70027122-70027144 CCTTCTAGCTCTGGGCTGCTTGG - Intronic
1118912855 14:70076244-70076266 CCTTGTCTGCCCGGTCTGCTTGG + Intronic
1120714069 14:87821766-87821788 CCTTCTTGGCCAGTCCTGCTTGG - Intergenic
1121052021 14:90825559-90825581 TCTTCTGTGCCTGGTCTGCTAGG - Intergenic
1121307728 14:92917528-92917550 CCTTATCTGCCAGGTCTGCATGG - Intergenic
1122305073 14:100759612-100759634 CCATCTATTCCAGGTTTGCTGGG - Intergenic
1122937880 14:104968234-104968256 CCTTGCATGCCAGGGCAGGTGGG + Intronic
1123122739 14:105925579-105925601 CCTTCTGGGCCTGGGCAGCTGGG + Intronic
1123149276 14:106165714-106165736 GCTTCTCTCCCAGGGCTGCAGGG + Intergenic
1123172748 14:106389901-106389923 GCTTCTCTCCCAGGGCTGCAGGG + Intergenic
1123405382 15:20017000-20017022 CCTTCTGGGCCTGGGCAGCTGGG + Intergenic
1123514712 15:21023648-21023670 CCTTCTGGGCCTGGGCAGCTGGG + Intergenic
1125083334 15:35701007-35701029 CTTTCTTTGCCTTGGCTGCTAGG + Intergenic
1125314728 15:38418923-38418945 CCTTCTATCCCAGGACAACTTGG - Intergenic
1125931784 15:43605278-43605300 CCCTCTCTGCCAGGGCTGCCTGG + Exonic
1125944884 15:43704756-43704778 CCCTCTCTGCCAGGGCTGCCTGG + Intergenic
1127084005 15:55408095-55408117 CCTCCTAGGCTGGGGCTGCTCGG - Intronic
1128228158 15:66017209-66017231 CCATCTCTGCCAGGCCTGATAGG - Intronic
1128680678 15:69649180-69649202 CCTTCTCTGCCAGAGCAGCTTGG - Intergenic
1129156742 15:73722824-73722846 CCTTTCCAGCCAGGGCTGCTGGG - Intergenic
1133372594 16:5256481-5256503 GCTTCTCTCCCAGGACTGCTAGG + Intergenic
1135413402 16:22251347-22251369 CTTTCCATGCCAGGGCAGCTGGG + Intronic
1136316772 16:29459115-29459137 CCTGGAATGCCTGGGCTGCTGGG + Intergenic
1136318777 16:29469050-29469072 CCTGGAATGCCTGGGCTGCTGGG + Intergenic
1136352690 16:29721357-29721379 CCTTCTCTGCCTCGGCTGCCAGG - Intergenic
1136431347 16:30198457-30198479 CCTGGAATGCCTGGGCTGCTGGG + Intronic
1136433349 16:30208394-30208416 CCTGGAATGCCTGGGCTGCTGGG + Intronic
1136737387 16:32476557-32476579 ACTTCTAGCCCTGGGCTGCTGGG - Intergenic
1137751539 16:50864542-50864564 CCCTCTGTGCCAGGCCTGCTGGG + Intergenic
1138418288 16:56883980-56884002 CTTTCTAGGCCAGAGCTGCTGGG - Intronic
1138660117 16:58511820-58511842 CCTTCTGTGCCTGGGCCGCCGGG - Exonic
1139332123 16:66201464-66201486 CCTTCTCTTCCAGGGATCCTGGG + Intergenic
1141548303 16:84787037-84787059 CCTGCTCTGCCAGGGCTCCCTGG - Intergenic
1141557212 16:84844115-84844137 CCAGCTGTGCCAGGGCTGCCTGG + Intronic
1141755635 16:85988949-85988971 CCTTCTGTGCCAGGCATCCTGGG + Intergenic
1142151746 16:88515561-88515583 CCCTGTCTGCCAGGGCAGCTGGG + Intronic
1203015683 16_KI270728v1_random:353020-353042 ACTTCTAGCCCTGGGCTGCTGGG + Intergenic
1203034018 16_KI270728v1_random:626178-626200 ACTTCTAGCCCTGGGCTGCTGGG + Intergenic
1142982380 17:3679695-3679717 ACATCTGGGCCAGGGCTGCTGGG - Exonic
1143033185 17:3979383-3979405 CCTTAGCTGCCAGGGATGCTGGG - Intergenic
1143923537 17:10349716-10349738 CCTTCTATCCTAGGCCTGCCTGG - Intronic
1144814108 17:18021305-18021327 TGTTCTCTGCTAGGGCTGCTGGG - Intronic
1146681805 17:34813892-34813914 GCTTCTAAGTCAGAGCTGCTAGG - Intergenic
1147122468 17:38343740-38343762 CCTCCTATGTGGGGGCTGCTGGG - Exonic
1147896935 17:43757326-43757348 CCTTCTAGGCAAGGTCAGCTGGG - Intronic
1150006882 17:61475502-61475524 CCATCTTTGGCTGGGCTGCTAGG - Intronic
1151935059 17:77256479-77256501 GCTCCTTTGCCAGGGGTGCTCGG - Intergenic
1152409753 17:80117478-80117500 CCGTCTGTGCCAGGCCTCCTAGG + Intergenic
1152510353 17:80782664-80782686 CCTTGAGAGCCAGGGCTGCTCGG - Intronic
1153307238 18:3643096-3643118 CCTTCTTTGCTAGGGTTGCATGG - Intronic
1154256404 18:12784475-12784497 CCTTATATGCCAGGTTTTCTAGG - Intergenic
1155391120 18:25337940-25337962 GCTTATATGGAAGGGCTGCTAGG + Intronic
1157166375 18:45361707-45361729 CCCTCTCGGCCAGGGCTGCTCGG + Intronic
1161966392 19:7551274-7551296 CCTCCTATGCCGGGGCTCCTGGG - Intronic
1163668578 19:18614298-18614320 CGTTCTATACCAGGCCTGCAGGG + Intronic
1167871563 19:52375021-52375043 CCTTCTAGGCCAGGCATGGTGGG - Intronic
1168075265 19:53978029-53978051 CCTTCTCTCTCTGGGCTGCTTGG - Intronic
1168638188 19:58012640-58012662 GCTTCCATGGCAGGGCTGCTGGG - Intergenic
927886962 2:26724644-26724666 ACATCTAGGCCAGGGCTGCCTGG + Intronic
931791088 2:65664964-65664986 CCTTCTAAGCCTGGGCTGTGGGG + Intergenic
932093528 2:68827252-68827274 CCTTCTATGTCAAGCCAGCTTGG + Intergenic
933943541 2:87265191-87265213 CCTTCTTTGCCATGGCTGCTGGG + Intergenic
933951815 2:87337628-87337650 GCATCTATGTCAGGGCTGCCAGG + Intergenic
934134243 2:88979844-88979866 GCATCTATGTCAGGGCTGCCAGG - Intergenic
934139127 2:89028242-89028264 GCATCTATGTCAGGGCTGCCAGG - Intergenic
934145199 2:89086250-89086272 GCATCTATGTCAGGGCTGCCAGG - Intergenic
934224054 2:90114305-90114327 GCATCTATGTCAGGGCTGCCAGG + Intergenic
934230116 2:90172317-90172339 GCATCTATGTCAGGGCTGCCAGG + Intergenic
934236059 2:90233942-90233964 GCATCTATGTCAGGGCTGCCAGG + Intergenic
936336680 2:111596386-111596408 CCTTCTTTGCCATGGCTGCTGGG - Intergenic
936551560 2:113446854-113446876 CTCTCTATGCCAGTGCTACTTGG + Intronic
937127544 2:119484024-119484046 CCTTCCCTGCCAGGGCTCCCTGG - Intronic
937258238 2:120569510-120569532 CCCTACATGCCAGGTCTGCTGGG - Intergenic
938082037 2:128375196-128375218 CCTCCTGAGCCAGCGCTGCTGGG - Intergenic
939629288 2:144514974-144514996 CCCTCTCTGCCAGGTCTCCTAGG + Intronic
941434099 2:165447110-165447132 TGTTCTGTGGCAGGGCTGCTAGG + Intergenic
943612039 2:190045272-190045294 CCTTCTATCCCTGGTCAGCTTGG + Intronic
943794911 2:191980289-191980311 CCTTCCAGGGTAGGGCTGCTGGG - Intronic
948695607 2:239731760-239731782 TCTTCTGTGCCAAGGCTGCTGGG + Intergenic
948980496 2:241492040-241492062 CCTTCTATGGCAGGGTGCCTGGG - Intronic
1169068241 20:2706495-2706517 CCATCTAAGGCTGGGCTGCTAGG - Intronic
1172486367 20:35300225-35300247 CCCTCCATGCCAGGCTTGCTTGG - Intergenic
1172831155 20:37836171-37836193 CCTTCTTTGCCTGGGCTATTAGG - Intronic
1173156594 20:40617704-40617726 CCTTCTGTGCCCTGGCTGATTGG - Intergenic
1173579146 20:44133634-44133656 CCTTCTATGTCAGGGCAGGATGG + Intronic
1174829734 20:53801576-53801598 AATTCTATCCCAGGACTGCTTGG - Intergenic
1175004920 20:55671691-55671713 GCTTCTATGCCAAGTATGCTGGG + Intergenic
1175014602 20:55775859-55775881 CCTTCTGGGCCAGTGGTGCTAGG + Intergenic
1175601052 20:60273506-60273528 CCTTCTCTGCCTGGGCAGCTCGG + Intergenic
1177983756 21:27947486-27947508 CCTTGTGTGCCAGGCCTCCTGGG + Intergenic
1179916134 21:44479378-44479400 CCTTCTCTGCCTCGGCTGCCAGG - Intergenic
1179969153 21:44824804-44824826 CCTTCTCAGACAGGGCGGCTGGG - Intergenic
1182682460 22:32091599-32091621 CCTTCTCTTCCAGGACTGCGAGG + Exonic
1183742186 22:39674934-39674956 CCCTTTATACCAAGGCTGCTGGG - Intronic
1184344408 22:43904202-43904224 CCTTCTCTGCCTCGGCTGCCAGG - Intergenic
1184817995 22:46886495-46886517 CCCTTTCTGCCAGGGCTACTTGG + Intronic
949177295 3:1080604-1080626 ACTTCTAACCCAGGGCTACTTGG + Intergenic
951538420 3:23760644-23760666 TCATCTCTGCCAGAGCTGCTGGG - Intergenic
952834504 3:37591785-37591807 CCCTCAAGGCCAGTGCTGCTGGG - Intronic
954081809 3:48216651-48216673 CCTTGGATGCCATGGCTGCAGGG - Intergenic
955491304 3:59485771-59485793 ACTTGTATGCCAGGGCTCCAGGG - Intergenic
955995397 3:64675533-64675555 CCTTCAATTCCAGGGCTCATGGG - Intronic
956729636 3:72184960-72184982 ACTTCTATGCCTGTGTTGCTTGG - Intergenic
957070422 3:75563729-75563751 GCTTCTCTCCCAGGACTGCTAGG - Intergenic
960483635 3:118224390-118224412 CCTTCTATGCCTAGGTTGTTTGG - Intergenic
961283666 3:125782806-125782828 GCTTCTCTCCCAGGACTGCTAGG + Intergenic
968225390 3:196969379-196969401 CCTTTCCTGTCAGGGCTGCTGGG - Intergenic
969227669 4:5809590-5809612 CCTGCTAAGCGTGGGCTGCTAGG + Exonic
969739944 4:9017020-9017042 GCTTCTTTCCCAGGACTGCTAGG + Intergenic
969799107 4:9548538-9548560 GCTTCTCTCCCAGGACTGCTAGG + Intergenic
970026059 4:11625322-11625344 CCTTCTATGCCGGGGCCACCTGG - Intergenic
974344625 4:60662666-60662688 CCTTCTCTGCCAGTGGTGCCTGG + Intergenic
976642877 4:87357602-87357624 TCTTCTATGTCAGGGCTTCTTGG - Intronic
978969108 4:114780789-114780811 ACTTCTATGCCAGTGATGCCCGG - Intergenic
979395417 4:120182266-120182288 TCTTCTATTCCAGGGATGCAAGG + Intergenic
980448227 4:132939143-132939165 CCCTCTGTGCCTGAGCTGCTAGG + Intergenic
981751077 4:148092764-148092786 CGTGCCATGCCAGGGGTGCTAGG + Intronic
981872084 4:149498512-149498534 CCTGCTGTACCAGGGTTGCTGGG - Intergenic
983877392 4:172893162-172893184 CCTTCTGTGCCAAGATTGCTGGG + Intronic
986131046 5:4930515-4930537 CCTTCTTTGCTGGGGCTGCCAGG - Intergenic
987100152 5:14583738-14583760 CCTTCTTTGCCAGTGGTGTTTGG + Intronic
987582997 5:19820279-19820301 CCTTCTGTGCCCGGATTGCTAGG - Intronic
990917610 5:60927744-60927766 CCTTCTATTCAAGGACAGCTGGG - Intronic
993820090 5:92603525-92603547 CTTTCTAAGCCATGGCTACTTGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997673577 5:135695830-135695852 CCTCCCATCCCAGAGCTGCTGGG - Intergenic
998561091 5:143172406-143172428 CCTTCTTTGTCGTGGCTGCTAGG - Intronic
998848257 5:146331621-146331643 CCTTCTCTGCCAGCCCTGCAGGG - Intronic
1000409580 5:160924087-160924109 CCAGCTAGGCCAGGGCTGCAAGG + Intergenic
1000483599 5:161810614-161810636 CCTCCGGTGCCAGGGCTGCATGG - Intergenic
1001310911 5:170610022-170610044 TCTTCTTTGCAAGGGCTGCTAGG - Intronic
1001551490 5:172605390-172605412 CCTTCTTTGCTTTGGCTGCTGGG - Intergenic
1002456073 5:179345830-179345852 CCTTGAATTCCAGGGCTGATGGG - Intergenic
1002887912 6:1312370-1312392 CCTTCTAAGCCCGGCGTGCTCGG + Intergenic
1004879704 6:19995769-19995791 CCTTCTGTTCCCGGGCTTCTGGG - Intergenic
1006017859 6:31096790-31096812 CCTACTATAACAGGGCTACTTGG - Intergenic
1007426064 6:41746973-41746995 CCTGCCATTCAAGGGCTGCTTGG + Intronic
1007498574 6:42278981-42279003 CCTTCTATGCCAGGGCTGCTAGG + Intronic
1008053704 6:46925442-46925464 CCTTCTAGTCCAGGGATGCAAGG - Intronic
1011554794 6:88563235-88563257 CCTTGAAAGCCAGGCCTGCTCGG - Intergenic
1013819174 6:114134729-114134751 CCTTCTATGCTGGGACTGCCAGG + Intronic
1018656414 6:166041393-166041415 CCTCCTCTGCCAGGGCTGTGGGG - Intergenic
1018990027 6:168667514-168667536 CCTTCTCTGCCAGTGCCACTCGG - Exonic
1021672494 7:23046647-23046669 CCTTCTCAGACAGGGCGGCTGGG + Intergenic
1022345268 7:29508588-29508610 CCTTCTTTGCCAGGACCACTAGG - Intronic
1023991960 7:45133855-45133877 CCTCCTACTCCAGGGCTGCAAGG + Intergenic
1026943662 7:74302996-74303018 TCTTCTCTGCCAGGCCTGCGGGG - Intronic
1027425736 7:78060022-78060044 TCTAATATGCCAGTGCTGCTGGG - Intronic
1029072695 7:97913033-97913055 GCTTCTCTCCCAGGACTGCTAGG - Intergenic
1031973455 7:128079533-128079555 CCTTCTATGGCTGGGCTTGTGGG - Intronic
1032022943 7:128420084-128420106 CCCTAGAGGCCAGGGCTGCTGGG - Intergenic
1033740682 7:144273582-144273604 CCTTCTATGCCCCAGCTGGTGGG - Intergenic
1033753225 7:144376031-144376053 CCTTCTATGCCCCAGCTGGTGGG + Intronic
1035333033 7:158108496-158108518 CCATACATGCCAGGGCTGCTGGG - Intronic
1036244971 8:7108265-7108287 GCTTCTCTCCCAGGACTGCTAGG + Intergenic
1036255768 8:7205520-7205542 ACTTCTCTCCCAGGACTGCTAGG - Intergenic
1036361717 8:8081979-8082001 ACTTCTCTCCCAGGACTGCTAGG + Intergenic
1036708846 8:11065197-11065219 CCTTCTTTGCCATGGGTGCCGGG - Intronic
1036889253 8:12585047-12585069 GCTTCTCTCCCAGGACTGCTAGG - Intergenic
1036896848 8:12643211-12643233 GCTTCTCTCCCAGGACTGCTAGG - Intergenic
1043544086 8:81295632-81295654 CTTTCTCTGCCAGGGCTGCCTGG + Intergenic
1046762361 8:118034519-118034541 CCATCATTGTCAGGGCTGCTGGG - Intronic
1048190354 8:132282626-132282648 CATGCTTTGCCAGGGCTGCTTGG + Intronic
1048376022 8:133822867-133822889 CCTTCTTGGGCAGGGCTCCTGGG + Intergenic
1049285884 8:141774995-141775017 ACTTCTCTGCATGGGCTGCTGGG - Intergenic
1049536817 8:143186312-143186334 CCTCCTCTGCCAGGGCTGAAAGG + Intergenic
1049562923 8:143321055-143321077 CCTGCTGTGCCGGGGCTGATCGG - Intronic
1049575597 8:143388438-143388460 CCTCCCATGCCAGCCCTGCTTGG - Intergenic
1049605976 8:143529385-143529407 CCTCTGATGCCAGGGCTGCGTGG + Intronic
1049901437 9:170288-170310 CTCTCTATGCCAGTGCTACTTGG - Intronic
1049947657 9:613164-613186 ACTTCTTTGCCTTGGCTGCTAGG - Intronic
1053483701 9:38436076-38436098 CCTTCTAGGCCAGAGTGGCTTGG - Intergenic
1053744472 9:41180595-41180617 CTCTCTATGCCAGTGCTACTTGG - Intronic
1054349740 9:64010495-64010517 CTCTCTATGCCAGTGCTACTTGG - Intergenic
1054482798 9:65684614-65684636 CTCTCTATGCCAGTGCTACTTGG + Intronic
1054683872 9:68250655-68250677 CTCTCTATGCCAGTGCTACTTGG + Intronic
1056678843 9:88699382-88699404 CCAGCTATGCTGGGGCTGCTGGG + Intergenic
1060408253 9:123383305-123383327 CCATCCCTGCCAGGGCTCCTTGG - Intronic
1062048781 9:134436702-134436724 CCTTCTCTGCCTGGCCTGTTTGG + Exonic
1186623228 X:11263676-11263698 CAGTCTCTGCCTGGGCTGCTGGG - Intronic
1188644695 X:32551299-32551321 GCTTCTATCCCAGGGTTGCGAGG + Intronic
1190020991 X:46875373-46875395 CCTCGTATGCCAGAGCTGTTTGG + Intronic
1192144322 X:68670962-68670984 CCATCAAGGCCAGAGCTGCTAGG - Intronic
1194103342 X:89735065-89735087 CCTTCTATGCCAATTTTGCTGGG + Intergenic
1194301805 X:92196750-92196772 CCATCCCTGGCAGGGCTGCTCGG + Intronic
1198435603 X:136614150-136614172 CTCTCTATGTCAGGGTTGCTAGG + Intergenic
1199424597 X:147686186-147686208 CCTTCTGTGCCAAGTTTGCTGGG - Intergenic
1199852771 X:151737242-151737264 TCTTCCCTGCCAGGGCTGGTTGG - Intergenic