ID: 1007499697

View in Genome Browser
Species Human (GRCh38)
Location 6:42287506-42287528
Sequence GACCCCTGCTTCACAGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 260}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007499692_1007499697 21 Left 1007499692 6:42287462-42287484 CCATGATCTGAAGCCGAAAGGCC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1007499697 6:42287506-42287528 GACCCCTGCTTCACAGAGAATGG 0: 1
1: 0
2: 1
3: 26
4: 260
1007499689_1007499697 28 Left 1007499689 6:42287455-42287477 CCCAAGTCCATGATCTGAAGCCG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1007499697 6:42287506-42287528 GACCCCTGCTTCACAGAGAATGG 0: 1
1: 0
2: 1
3: 26
4: 260
1007499693_1007499697 8 Left 1007499693 6:42287475-42287497 CCGAAAGGCCTCTGTCTCAGCAG 0: 1
1: 0
2: 2
3: 17
4: 247
Right 1007499697 6:42287506-42287528 GACCCCTGCTTCACAGAGAATGG 0: 1
1: 0
2: 1
3: 26
4: 260
1007499690_1007499697 27 Left 1007499690 6:42287456-42287478 CCAAGTCCATGATCTGAAGCCGA 0: 1
1: 0
2: 0
3: 9
4: 49
Right 1007499697 6:42287506-42287528 GACCCCTGCTTCACAGAGAATGG 0: 1
1: 0
2: 1
3: 26
4: 260
1007499694_1007499697 0 Left 1007499694 6:42287483-42287505 CCTCTGTCTCAGCAGACGACCCT 0: 1
1: 0
2: 3
3: 6
4: 112
Right 1007499697 6:42287506-42287528 GACCCCTGCTTCACAGAGAATGG 0: 1
1: 0
2: 1
3: 26
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007499697 Original CRISPR GACCCCTGCTTCACAGAGAA TGG Intronic
901134621 1:6984936-6984958 GGACCCTGCTTCCCAGAGAAAGG + Intronic
903032332 1:20472810-20472832 GGACCCTGCTTCATAGAGCAGGG + Intergenic
903216377 1:21845776-21845798 TACCCCTTCTTTACAGATAAGGG + Intronic
904284228 1:29443668-29443690 AACCCCTGCTTCCCAGTGCAAGG - Intergenic
905008872 1:34733270-34733292 TAACCCTGCTTCACAGACAAAGG - Intronic
907308686 1:53527454-53527476 AACCCCTGCTTCAGAGAGCGAGG - Intronic
907404809 1:54247377-54247399 GGCCCCTGCTGCCCAGAAAATGG - Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
910744707 1:90561033-90561055 GCCCCCTGCTTCTCTGAGACAGG + Intergenic
910842263 1:91572003-91572025 GCCCCCTGCCTCACAGGGGATGG + Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
913588168 1:120296828-120296850 CACCCCAGCTTCACAGAAGATGG - Intergenic
913620017 1:120601541-120601563 CACCCCAGCTTCACAGAAGATGG + Intergenic
914570185 1:148908701-148908723 CACCCCAGCTTCACAGAAGATGG - Intronic
914602643 1:149221568-149221590 CACCCCAGCTTCACAGAAGATGG + Intergenic
916504145 1:165412546-165412568 AATCTCTGCTTCACAGATAAGGG - Intronic
916726350 1:167527019-167527041 GAGCCAGGCTTCACAGTGAAGGG - Intergenic
917215227 1:172671294-172671316 GAACCCTCCTCCACAAAGAATGG - Intergenic
918632796 1:186738872-186738894 GAAGACTGCTTCAAAGAGAAGGG - Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920034066 1:203054342-203054364 GATCCCTGTTTTACAGACAAGGG + Intronic
920172494 1:204080556-204080578 GCCCCCTGCTTGACTCAGAATGG + Intronic
920353357 1:205352400-205352422 CACCCCTTGTTCCCAGAGAAAGG + Intronic
921264437 1:213410685-213410707 GACACAGGCCTCACAGAGAATGG + Intergenic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923465711 1:234246397-234246419 AGGCCCTGCTTCTCAGAGAAAGG - Intronic
1062965730 10:1606417-1606439 GAGCCCTGCTTCACAGCCCAAGG + Intronic
1065542709 10:26785896-26785918 GCCCACTGCTCCACAGAGGAAGG - Intronic
1070130212 10:73650735-73650757 GACCACAGCATCACTGAGAAAGG + Intronic
1070344488 10:75528503-75528525 AACCCCTGCTTCAGGGATAAAGG - Intronic
1071078768 10:81784547-81784569 GCCCCCTGCTTCACGGAGCCTGG + Intergenic
1071481396 10:86067677-86067699 GGCCTCTGCCTCACACAGAAAGG + Intronic
1071697517 10:87892310-87892332 AATGGCTGCTTCACAGAGAAAGG - Intronic
1071816692 10:89239579-89239601 GCACCCTGCATCACAGAGCAGGG + Intronic
1073295289 10:102435049-102435071 GACTCCTGCTGCACAGAGCTGGG - Intergenic
1073786413 10:106895169-106895191 AACCCCTGCTACAAAGGGAAGGG - Intronic
1075578483 10:123598141-123598163 GACCTCTAATTCACAGAGAGAGG + Intergenic
1076633662 10:131868640-131868662 GACCACTGCTGCAGAGAGAAGGG + Intergenic
1076769826 10:132656829-132656851 GAGCCCTGCTGCATAGGGAAGGG - Intronic
1078530016 11:12130132-12130154 GACCTCAGATCCACAGAGAAGGG - Intronic
1078706043 11:13745245-13745267 GCTCCCTGCTGGACAGAGAATGG + Intergenic
1078812702 11:14784192-14784214 AACCCCTGCTTTAAACAGAAAGG + Intronic
1079321637 11:19456413-19456435 TATCCCTACTTCACAGATAAAGG + Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080588069 11:33699325-33699347 TTCCCCTGCCACACAGAGAAGGG - Intronic
1082794316 11:57368837-57368859 GACCACAGCTGCACAGAGAGAGG - Intronic
1082969523 11:59004989-59005011 TGCCCCTGCTTCCTAGAGAATGG - Intronic
1083628085 11:64082234-64082256 GGCCCCTGCTTAGCAGAGGATGG + Intronic
1084583731 11:70041289-70041311 GACCCCTGGATCACAAAGCAAGG + Intergenic
1084647342 11:70466125-70466147 AACCCCTGTTTCTCAGAGAAAGG - Intergenic
1085902583 11:80719418-80719440 CACCCCTGCTTGACAGAGTAAGG + Intergenic
1088877828 11:113950565-113950587 GATTCCTGTTTCATAGAGAAAGG + Intergenic
1089054519 11:115574798-115574820 GACCCCTTGTTCAAAGAGCAGGG - Intergenic
1090037074 11:123258471-123258493 GCACCCTGATCCACAGAGAAAGG - Intergenic
1091558280 12:1592667-1592689 AACCCCAGCTGCAAAGAGAATGG + Intronic
1091660073 12:2376824-2376846 CCTCCCTGCTTCACAGAGATGGG + Intronic
1091842163 12:3628971-3628993 GCCCTCTGCTTCACAGATGAGGG + Intronic
1092407430 12:8230714-8230736 GATCCCTGCTTCACACAGCCAGG + Intergenic
1092953845 12:13531598-13531620 GAGCCCTGCTTTTCAGGGAAAGG - Intergenic
1093867038 12:24239865-24239887 GACATCGGCTTCAAAGAGAATGG - Intergenic
1096431240 12:51545042-51545064 GACCCCTGCTGTAGAGGGAAAGG - Intergenic
1099152380 12:79130769-79130791 GACTCCTGGTTCAAAGACAAAGG - Intronic
1099787607 12:87286528-87286550 GACTCATGCTTCACAGAATATGG - Intergenic
1100131177 12:91495667-91495689 GACTCTGGCTTCACTGAGAAAGG - Intergenic
1101711199 12:107268412-107268434 GCCCCCTGCTTCTCACAGCATGG + Intergenic
1101733324 12:107444300-107444322 AACCCAGGCTACACAGAGAAGGG + Intronic
1104163507 12:126203982-126204004 GACTCCTGTGACACAGAGAATGG + Intergenic
1104203933 12:126617977-126617999 GACCCCTTCTTGAAGGAGAATGG + Intergenic
1104764261 12:131316211-131316233 TTTCCCTGCTTTACAGAGAAGGG + Intergenic
1104815289 12:131642188-131642210 TTTCCCTGCTTTACAGAGAAGGG - Intergenic
1105004554 12:132713207-132713229 AACACCTGCTTAAAAGAGAAAGG - Intronic
1105534215 13:21248736-21248758 GACCCATGCTTCACAGTAAGGGG + Intergenic
1108787083 13:53917556-53917578 GTCCCCAGCTTCTCAGAGGAAGG + Intergenic
1108872378 13:55003442-55003464 GACCCCTCCTTCTCAGCCAAGGG + Intergenic
1112793256 13:103027621-103027643 GACCCTGGCTTCACAGATACAGG - Intergenic
1117075633 14:52100865-52100887 GATCCCTGTTTAACAGATAAAGG - Intergenic
1117767389 14:59097179-59097201 GTCCCCTGCTTGATAGAGGAAGG - Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1119195117 14:72712078-72712100 GGCCCCTGCTCCACCGAGAGAGG + Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1120397325 14:83985195-83985217 GACCCCTGTTACTGAGAGAAAGG + Intergenic
1122614630 14:103008718-103008740 AACCTTTTCTTCACAGAGAAAGG + Intronic
1122855927 14:104560030-104560052 GACCCCGGCTTCACACAGACAGG + Intronic
1125226158 15:37398632-37398654 TACTCCTGCTTAACAGACAAGGG + Intergenic
1125418143 15:39474677-39474699 GAGCCCAGCTTCTCAGAGGAGGG - Intergenic
1126701648 15:51373169-51373191 TACTCCTGCTCCCCAGAGAAAGG - Intronic
1128465012 15:67903145-67903167 GACCCATGCTTCAGACAGACTGG - Intergenic
1129366900 15:75061707-75061729 GGCCATTGCTTCACAGAGCATGG - Intronic
1129793471 15:78358274-78358296 GACAACTGCTTCAAAGAGAACGG + Intergenic
1131352718 15:91716338-91716360 GAGCCCTGCAGCACATAGAAGGG + Intergenic
1131368605 15:91861065-91861087 GCCACCTGATTCACTGAGAAAGG - Intronic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1132106188 15:99064414-99064436 CACACCTGCTCCACGGAGAAAGG + Intergenic
1132206451 15:99989186-99989208 CACCCCTGCTGCACAGAAGAGGG - Intronic
1133168031 16:3962596-3962618 GAGCACTGCTTCAGAGAGGAGGG - Intronic
1133974894 16:10593671-10593693 GACCCCTGTTTTACAGATGAGGG + Intergenic
1133977020 16:10606696-10606718 GCCCCCGGCTTCCCAGAGGAAGG + Intergenic
1137672297 16:50286042-50286064 AAGCCGTGCTTCACAGAAAAGGG - Intronic
1137675046 16:50299960-50299982 GGCCCCTGCTTCCCAGGGATTGG + Intronic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1139787691 16:69407193-69407215 CACCACTACTTCACACAGAATGG + Intronic
1139954918 16:70688491-70688513 TAGCCCTGCCTCTCAGAGAAAGG - Intronic
1139961472 16:70720542-70720564 TCCCACTGCTTCAGAGAGAAAGG - Intronic
1140472909 16:75225070-75225092 GGCTCCTGCTTCCCAGAGAGTGG + Intergenic
1143579550 17:7817663-7817685 GACGCCTTCTCCACTGAGAATGG + Exonic
1144044458 17:11442412-11442434 GAGCCCTGCTTCTGAGAGACCGG + Intronic
1145990092 17:29074143-29074165 GTCTCCAGCTGCACAGAGAAAGG + Exonic
1146279028 17:31533197-31533219 GACACCTGCTTGACAGAGGCAGG + Exonic
1148497165 17:48059877-48059899 CACCCCTGCCTCACAGGAAAGGG - Exonic
1149697659 17:58629093-58629115 GACACCTTCTTGACAGAGAAGGG - Intronic
1150009759 17:61492909-61492931 GCCCTCCACTTCACAGAGAAGGG + Intergenic
1151057706 17:71052770-71052792 GAACCCTCCTTCTCAGAGAAGGG + Intergenic
1152115572 17:78384940-78384962 GGCGCCCGCTTCTCAGAGAAGGG - Intronic
1154502714 18:15004607-15004629 GCCCCCTGCTTCGCAGTGATGGG - Intergenic
1157182460 18:45509860-45509882 GACCTCTGCTGCATAGAGAAAGG + Intronic
1157676353 18:49571547-49571569 GGCCCCTTCTCTACAGAGAAAGG - Intronic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160094303 18:75857411-75857433 GAACCCTGCTCAACAGACAAAGG + Intergenic
1160458776 18:79021707-79021729 GACTCCTGGGTCAGAGAGAAAGG + Intergenic
1162793759 19:13076222-13076244 GGGCCCAGCTTCACAGAGAGAGG + Intronic
1163201540 19:15773105-15773127 GACCCCTGGGTCAGAGACAAAGG - Intergenic
1165409197 19:35648459-35648481 GACCCCAGCTTCCCTGAGAACGG + Intronic
1165782351 19:38441845-38441867 GACCTCTGCTTCACAGACACAGG - Intronic
925808215 2:7673344-7673366 CACTCCTGCTGCAGAGAGAAAGG + Intergenic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929655282 2:43725005-43725027 CACCTCTCCATCACAGAGAAGGG + Intronic
929775827 2:44929910-44929932 GACTCCTGCTTCCTAGAGAAGGG + Intergenic
931123973 2:59253277-59253299 GACCACTGCTCCACACAGTAAGG - Intergenic
931628054 2:64274798-64274820 GAAAACTGATTCACAGAGAAAGG - Intergenic
931756993 2:65383311-65383333 GGCCCCGGCCTCACAGACAAGGG - Intronic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
934574328 2:95390798-95390820 GGGCCCTGCTTCACAGGGAAGGG + Intergenic
934715196 2:96538972-96538994 GACCCCTGTTGCCCAGAGAGGGG - Intronic
937205990 2:120237570-120237592 GACCCCAGCTGCAGAGAGACCGG + Intergenic
938377097 2:130815175-130815197 GGTCCGTGCTTCACAGAGAAGGG + Intergenic
938501882 2:131834777-131834799 GCCCCCTGCTTCGCAGTGATGGG - Intergenic
939012719 2:136865226-136865248 AAACCATGCTTCATAGAGAATGG + Intronic
941398676 2:165003709-165003731 GACCCCTGCTACTCAAAGTATGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
946745616 2:222842593-222842615 GATTCCTGCTTTACAGAGACAGG + Intergenic
947149007 2:227095346-227095368 GTCCCCTGCTACAGAGGGAAAGG - Intronic
948471166 2:238180671-238180693 GACTCCTTCATCTCAGAGAAGGG - Intronic
1168848311 20:959894-959916 GACCCCATCTTTGCAGAGAAAGG - Exonic
1169200494 20:3706850-3706872 GACCCCTGGGGCACTGAGAAGGG - Intronic
1169492781 20:6085329-6085351 GCCCCCTGCTGCACACAGAGGGG + Intronic
1170581282 20:17701339-17701361 AACACCTGCTTCACAGAGGTCGG - Intronic
1171489190 20:25504575-25504597 GAACCCGGCCACACAGAGAAGGG + Intronic
1171862330 20:30412574-30412596 TACCCCTGAGTCACAGAGAAGGG + Intergenic
1173994403 20:47326650-47326672 GATCCCTGCTTCTCATAGCAGGG - Intronic
1174513135 20:51071040-51071062 AACACCTTCTTCACAGAGGAAGG - Intergenic
1175213324 20:57375441-57375463 GTCACCTGCTTCACATAGGAGGG + Intronic
1175692922 20:61078945-61078967 TACCCATTCTTCACAGAAAACGG + Intergenic
1175785954 20:61711989-61712011 GACCCCTCCTGCACAGAGTGGGG - Intronic
1177127222 21:17210166-17210188 GACTCCTGGGTCAGAGAGAAAGG - Intergenic
1178733533 21:35128598-35128620 GAGCCCTGTTACACACAGAATGG + Intronic
1179076541 21:38127696-38127718 GAACCCTGACTCACACAGAAGGG - Intronic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1180295275 22:10928690-10928712 TACCCCTGAGGCACAGAGAAGGG - Intergenic
1181552985 22:23651651-23651673 GACCCCTGGTTCACAGACCTGGG - Intergenic
1183585231 22:38749590-38749612 CACCCCTGCCTGACAGAGGATGG - Intronic
950335310 3:12188468-12188490 CACCCCTGCTTCTCAGAGTGAGG + Intronic
956644932 3:71446141-71446163 GGCCCAGGCTTCTCAGAGAAGGG - Intronic
956866748 3:73376663-73376685 ATCCCCTGCTTCTCAGAAAATGG + Intergenic
958809609 3:98845570-98845592 GACCCGCTCTTCACAGAGCAGGG + Intronic
959227370 3:103603082-103603104 GAGTCCTGCTCCCCAGAGAAGGG + Intergenic
959524545 3:107361807-107361829 GACTCCTGCATCAGAGACAAAGG - Intergenic
960255558 3:115507156-115507178 AACTCCTGGTTCAGAGAGAAAGG - Intergenic
961020138 3:123498398-123498420 GACCCCTCTTTCAGAGAGTAGGG - Intronic
962207900 3:133450165-133450187 GACACAGGCTTCACAGAGACTGG - Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
965604670 3:170486144-170486166 GACTCCTTCCTGACAGAGAAGGG + Intronic
967658976 3:192082062-192082084 AATCCCTGATTCACAAAGAAAGG + Intergenic
967779510 3:193419907-193419929 TACCCCAGCTTCACAGAGTATGG + Intronic
967795894 3:193598306-193598328 GCCCTCTACTTCACAGAGAATGG - Intronic
969150678 4:5166329-5166351 TATCCCCGCTTCACAGAGAGAGG - Intronic
969321359 4:6414927-6414949 GACCCTGAGTTCACAGAGAAAGG - Intronic
969866102 4:10077979-10078001 GACCCCCCCTTCACAAAGGATGG - Intronic
970731291 4:19107049-19107071 GTCCCATGCTTCAAAGTGAATGG - Intergenic
971043604 4:22780962-22780984 CGCTCATGCTTCACAGAGAAGGG + Intergenic
972533729 4:39982345-39982367 AACCCCTGCTTCCCAGAGTCAGG - Intergenic
973089639 4:46118638-46118660 GAACCCTGCTTAACACACAATGG + Intronic
974333840 4:60514242-60514264 GAACCTTACTTGACAGAGAATGG + Intergenic
975512764 4:75211629-75211651 GACCTCTGTTTCACACACAATGG + Intergenic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
979350253 4:119636217-119636239 GACTCCTGATTCACAGAAACTGG - Intergenic
979377390 4:119963061-119963083 GAGCCCTGATTGACAGAGAAAGG - Intergenic
979381042 4:120007103-120007125 GAGCCCCGATTGACAGAGAAAGG + Intergenic
979689851 4:123548372-123548394 TATCCCTGCTTCTCAGAGAGAGG - Intergenic
980638237 4:135538309-135538331 TGCCCCTGGTTCATAGAGAATGG - Intergenic
980969997 4:139558605-139558627 GACCCCTGCTTCACCGACGGCGG - Intronic
981010749 4:139922424-139922446 CAGGCCTGCTTCAGAGAGAACGG + Intronic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
984051538 4:174870776-174870798 GACTCCTGAGTCACAGAAAAAGG - Intronic
985370852 4:189284161-189284183 TACCCCTGAGGCACAGAGAAGGG - Intergenic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
987400431 5:17469955-17469977 AACCCCTGCAACACAGTGAAGGG + Intergenic
987767469 5:22251556-22251578 CATCCCTGCTTTACAGATAAGGG - Intronic
987933742 5:24435926-24435948 GACTCCTGGGTCACAGATAAAGG + Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988033564 5:25797153-25797175 GCCCCCTGCCCCACAGAGGAGGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
989816333 5:45742154-45742176 CACACTTGCTTCATAGAGAATGG + Intergenic
992425673 5:76654760-76654782 GACCTCTTCTTCAAAGAAAATGG + Intronic
992553323 5:77880117-77880139 TATCCCTGCTTCACAGATAAAGG + Intergenic
993034079 5:82737709-82737731 CAACCATGCTTCACACAGAAAGG + Intergenic
993872347 5:93267773-93267795 CACCCCTGCTTGACACAGATAGG + Intergenic
995192171 5:109329538-109329560 GACCCCTGGATCAGAGACAAAGG - Intergenic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995847719 5:116512007-116512029 GAGACCTGCTTCACAGAGGCTGG + Intronic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG + Intronic
999710203 5:154311587-154311609 AACCCGTGTCTCACAGAGAATGG + Intronic
1001974335 5:175984569-175984591 CCTCCCTGCTTCCCAGAGAATGG + Intronic
1002243099 5:177859210-177859232 CCTCCCTGCTTCCCAGAGAATGG - Intergenic
1002260157 5:177987654-177987676 CACCCGTGCTTCAGAGGGAATGG - Intergenic
1003571713 6:7260610-7260632 CACCCCTCCTGCACAGAAAAGGG + Intergenic
1005024611 6:21450522-21450544 CATCCCTAATTCACAGAGAATGG - Intergenic
1005185095 6:23156578-23156600 GACACCTGCATGCCAGAGAATGG + Intergenic
1006020979 6:31117436-31117458 GACCCCTGCCTCACTGGGAAGGG - Exonic
1006383954 6:33718500-33718522 AGCCCCTGCTCCACAGAGATGGG + Intergenic
1006448481 6:34092685-34092707 GTCCCCAGCTCCAGAGAGAAGGG - Intronic
1006732406 6:36246138-36246160 CACCCCTGCTGCACAGATGAGGG + Intronic
1006979535 6:38135890-38135912 AATACCTGCTCCACAGAGAAGGG - Intronic
1007499697 6:42287506-42287528 GACCCCTGCTTCACAGAGAATGG + Intronic
1007812945 6:44499129-44499151 GACTTCTACTTCAAAGAGAAAGG + Intergenic
1007836600 6:44678684-44678706 CTCCACTGCTTCAGAGAGAAGGG + Intergenic
1010451421 6:76008142-76008164 AATCCCAGCTTCACAGAAAAGGG + Intronic
1012022439 6:93941468-93941490 GACCCATTCTTCACACACAAAGG - Intergenic
1012157840 6:95841992-95842014 GACTTCTGGTTCACAGACAAAGG - Intergenic
1012432958 6:99185519-99185541 GACCGCTGCTCCACAAAGAGGGG - Intergenic
1012880412 6:104781425-104781447 GAGCCCTGGTTCATTGAGAATGG + Intronic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1016085909 6:139913982-139914004 GACCCCTGCTACTCAAAGTATGG - Intergenic
1016262848 6:142193990-142194012 GACATTTGCTTCTCAGAGAATGG + Intronic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019664999 7:2247380-2247402 GTCCCCTGCCCCACAGAGGAGGG - Intronic
1019830856 7:3328462-3328484 GACCCAAACTTCACACAGAAAGG + Intronic
1020013993 7:4820602-4820624 CTCCCCTCCTTCACAGGGAAGGG - Intronic
1024300500 7:47884112-47884134 GCCACCTGCTTCCCAGAGGAGGG + Intronic
1027398800 7:77786447-77786469 GACCCCTGCTTTACAGTACAGGG + Intergenic
1029960148 7:104681692-104681714 TACCCCTGTTTTACAAAGAAGGG + Intronic
1030563944 7:111127579-111127601 GACATCTGCTTCAATGAGAATGG + Intronic
1030992320 7:116315337-116315359 GACCACTGCCTCACAGACAGTGG + Intronic
1031042380 7:116851744-116851766 GACCCCAGATTCAAAGACAAAGG + Intronic
1033538027 7:142329557-142329579 GAGACCTGTTTCACAGATAATGG + Intergenic
1034258221 7:149736077-149736099 GACCCCTGCTTAGAAGGGAAAGG - Intergenic
1039706496 8:40012785-40012807 AACAGCTGCTTCACAGAGCATGG + Intronic
1040425379 8:47279956-47279978 GAGCCATGCTTCAGAGAGAGAGG - Exonic
1040899595 8:52404321-52404343 GACCCATCCTGCACAGAGAAGGG + Intronic
1041096618 8:54356523-54356545 GACCCCAGCTGAAAAGAGAAGGG + Intergenic
1041261119 8:56021209-56021231 GACCCCAGCTTCAAACAGGATGG + Intergenic
1042172330 8:66004260-66004282 AAGCCCTGCTTCACAAAGACAGG - Intergenic
1043006474 8:74825290-74825312 GGTACTTGCTTCACAGAGAAGGG - Exonic
1044852624 8:96444019-96444041 AACCCCTGTTTTACAGATAAGGG - Intergenic
1046238127 8:111454068-111454090 GAAGCCTGCTTCACAAAGATAGG - Intergenic
1048581596 8:135733596-135733618 AACCCTGGCTTAACAGAGAAAGG - Intergenic
1049081739 8:140448637-140448659 TGCCCCTGCTTTACAGAGAAGGG - Intronic
1049671089 8:143870192-143870214 GACACCTGCTTCCCAGAGAAGGG + Exonic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1057066281 9:92055048-92055070 GACCCCTACTCCACAAAAAAGGG + Intronic
1058703753 9:107622096-107622118 GGCCCCTGCTTCTCAGGGACCGG + Intergenic
1059609783 9:115879719-115879741 GACACCTGGGTCACAGGGAAGGG + Intergenic
1059696631 9:116735994-116736016 GACACCTACTTCACAGAGTTGGG - Intronic
1059795080 9:117685630-117685652 GTCCCCTGATGCTCAGAGAATGG - Intergenic
1060203203 9:121664715-121664737 GACCCCTGGGTCAGAGACAAAGG + Intronic
1060732929 9:126049480-126049502 GACCCCTGCCTCACAGACAGGGG - Intergenic
1060813463 9:126622915-126622937 TACCCCCTTTTCACAGAGAAGGG - Intronic
1060894787 9:127210680-127210702 GTCCCCTGCTTCAGAGGAAAAGG - Intronic
1060963524 9:127698709-127698731 CACACGTGCTTCAGAGAGAATGG - Intronic
1061499666 9:130994600-130994622 GGCCCCTGCACCACCGAGAAGGG + Intergenic
1062418412 9:136466000-136466022 GGCCCCGGCTTCCCAGAGTATGG - Exonic
1203446709 Un_GL000219v1:63564-63586 TACCCCTGAGGCACAGAGAAGGG - Intergenic
1185616610 X:1425800-1425822 GAGCCTTCTTTCACAGAGAACGG + Intronic
1186733770 X:12439303-12439325 GACCCCTAGGTCACAGAGAAAGG - Intronic
1186780770 X:12909818-12909840 GGCCCCTGCTTTACAGACATGGG - Intronic
1189920734 X:45900943-45900965 GGCCCCTGCTGCTCAGTGAAGGG + Intergenic
1194116027 X:89899660-89899682 GACCACTGCTCCCCAGGGAATGG + Intergenic
1196293050 X:113966186-113966208 TACCCCTGCTTCACAGCTAGTGG + Intergenic
1198371022 X:135989157-135989179 TACTCCTGCTTCTCAGATAAAGG - Intronic
1199409827 X:147508608-147508630 AACCCCAACTTCACAGACAATGG - Intergenic
1199445772 X:147919141-147919163 GACCCCTTATTTACAAAGAAGGG - Intronic
1199886903 X:152029262-152029284 GTCCCCAGCTTGTCAGAGAATGG - Intergenic
1200468826 Y:3556785-3556807 GACCACTGCTCCCCAGGGAATGG + Intergenic
1201306375 Y:12554212-12554234 GCCCCCTGCTTACCAGAGACAGG + Intergenic