ID: 1007499697

View in Genome Browser
Species Human (GRCh38)
Location 6:42287506-42287528
Sequence GACCCCTGCTTCACAGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 260}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007499694_1007499697 0 Left 1007499694 6:42287483-42287505 CCTCTGTCTCAGCAGACGACCCT 0: 1
1: 0
2: 3
3: 6
4: 112
Right 1007499697 6:42287506-42287528 GACCCCTGCTTCACAGAGAATGG 0: 1
1: 0
2: 1
3: 26
4: 260
1007499692_1007499697 21 Left 1007499692 6:42287462-42287484 CCATGATCTGAAGCCGAAAGGCC No data
Right 1007499697 6:42287506-42287528 GACCCCTGCTTCACAGAGAATGG 0: 1
1: 0
2: 1
3: 26
4: 260
1007499690_1007499697 27 Left 1007499690 6:42287456-42287478 CCAAGTCCATGATCTGAAGCCGA 0: 1
1: 0
2: 0
3: 9
4: 49
Right 1007499697 6:42287506-42287528 GACCCCTGCTTCACAGAGAATGG 0: 1
1: 0
2: 1
3: 26
4: 260
1007499689_1007499697 28 Left 1007499689 6:42287455-42287477 CCCAAGTCCATGATCTGAAGCCG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1007499697 6:42287506-42287528 GACCCCTGCTTCACAGAGAATGG 0: 1
1: 0
2: 1
3: 26
4: 260
1007499693_1007499697 8 Left 1007499693 6:42287475-42287497 CCGAAAGGCCTCTGTCTCAGCAG 0: 1
1: 0
2: 2
3: 17
4: 247
Right 1007499697 6:42287506-42287528 GACCCCTGCTTCACAGAGAATGG 0: 1
1: 0
2: 1
3: 26
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007499697 Original CRISPR GACCCCTGCTTCACAGAGAA TGG Intronic