ID: 1007500506

View in Genome Browser
Species Human (GRCh38)
Location 6:42293356-42293378
Sequence TCAAGGGAGATGAGAACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007500503_1007500506 -7 Left 1007500503 6:42293340-42293362 CCTGGTAGAAGCCAACTCAAGGG 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1007500506 6:42293356-42293378 TCAAGGGAGATGAGAACCAAAGG 0: 1
1: 0
2: 1
3: 22
4: 234
1007500498_1007500506 30 Left 1007500498 6:42293303-42293325 CCGAGGGAGGAAGAGAGAGTTCC 0: 1
1: 0
2: 2
3: 31
4: 479
Right 1007500506 6:42293356-42293378 TCAAGGGAGATGAGAACCAAAGG 0: 1
1: 0
2: 1
3: 22
4: 234
1007500501_1007500506 9 Left 1007500501 6:42293324-42293346 CCAAAGGATCACACATCCTGGTA 0: 1
1: 0
2: 0
3: 18
4: 314
Right 1007500506 6:42293356-42293378 TCAAGGGAGATGAGAACCAAAGG 0: 1
1: 0
2: 1
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007500506 Original CRISPR TCAAGGGAGATGAGAACCAA AGG Intronic
901095923 1:6679511-6679533 TCAGGGGAGAAGAGACCCAAAGG - Intronic
902626807 1:17681441-17681463 TTAAGAGACATGAAAACCAAAGG - Intronic
902704235 1:18193329-18193351 CCAAGGGAGACGAGAACCATGGG + Intronic
903278062 1:22233998-22234020 TCATGGGGGCTGGGAACCAAAGG - Intergenic
903297746 1:22355914-22355936 TCAGGGGAGATGAATCCCAAAGG + Intergenic
903602619 1:24553729-24553751 ACAGGGGAGCTGAGACCCAAAGG - Intergenic
905518592 1:38580225-38580247 TCAAGGGAGAAGAAAAGCTATGG + Intergenic
910218326 1:84864559-84864581 TCAAGTGAGATGAGAAGCTATGG - Intronic
912280875 1:108312098-108312120 TGTAGGGAGATGAGAAACACAGG + Intergenic
912522620 1:110256224-110256246 ACAAGCGAGATGAAAACCCAAGG + Intronic
912747782 1:112259915-112259937 TCATGGGAGATGCAAACCTAGGG - Intergenic
914441694 1:147713153-147713175 TCAAGGGAGACGAGACCAATTGG + Intergenic
914679756 1:149930940-149930962 TCAAGGAAGAGGAGAAACACCGG + Exonic
914894568 1:151657564-151657586 TGAAGGGAGCTGAAAACCTAGGG - Intronic
915128948 1:153683940-153683962 CCAAGGGAGATGAGGAAGAAAGG + Intronic
916058794 1:161085255-161085277 CAAAGGGAGATGAGAACAATGGG + Intronic
916346426 1:163796963-163796985 AAAAGAGAGATGAGAAACAAAGG + Intergenic
916452081 1:164930416-164930438 TTGAGGGACAGGAGAACCAATGG - Intergenic
916986037 1:170192066-170192088 TCCAGGGAGCTGAGAATCCAGGG - Intergenic
917472543 1:175337894-175337916 TCATGGGATCTGAGAACTAAAGG + Intronic
918279569 1:182990703-182990725 GAAAGGGAGATGAGAACAAATGG - Intergenic
920840228 1:209547693-209547715 ACAAGGGAGATGAGGCCCACTGG - Intergenic
923357546 1:233175338-233175360 TCAAAGGGTATGAAAACCAAGGG + Intronic
923558431 1:235020406-235020428 TCAAGGGAGAGGAGCACTTAAGG + Intergenic
924466279 1:244301794-244301816 TCTAGGGAGAGGAAACCCAAAGG + Intergenic
924803540 1:247345148-247345170 TCAAGGGTGATCAGTATCAACGG - Intergenic
1065440955 10:25753001-25753023 TCAAGGGAGATTAAAAACATTGG + Intergenic
1072496557 10:95966923-95966945 TTAAGGGAGATGGGATCCATAGG - Intronic
1072531481 10:96323555-96323577 TCATGGGACATGAGGACCATGGG + Intronic
1074082960 10:110182316-110182338 ACAAGGGAGATGAGAATCTTGGG - Intergenic
1075140961 10:119835149-119835171 ACAAGGGAGAGGAGAAGGAACGG + Intronic
1077701721 11:4448512-4448534 TCAAGGGAAATGACAACAGAAGG + Intergenic
1078825983 11:14930734-14930756 CCAAGAGTGGTGAGAACCAATGG - Intronic
1080585366 11:33676745-33676767 TCCAGGTAAAAGAGAACCAAAGG + Intergenic
1085204359 11:74721581-74721603 TCAAGTGAGATGAGTGCCCAAGG + Intronic
1086823847 11:91470727-91470749 CCAAGGGAAAAGAGAACCAGAGG - Intergenic
1086885485 11:92200678-92200700 TCAAGTGAGATGGTAACCATTGG + Intergenic
1088340472 11:108760081-108760103 TCAAAGAAAATGAGAAACAAAGG - Intronic
1089378935 11:118013930-118013952 TCAAGGGAGATGGGGACCCAGGG - Intergenic
1089527304 11:119105962-119105984 TCAAGGGAGGAGAGAACTCAGGG - Intronic
1090052361 11:123390844-123390866 TCAAGTGAGATGGGAAGAAAGGG - Intergenic
1090371866 11:126261334-126261356 TAAAGGGAGATGAGGACATATGG - Intronic
1090548466 11:127792174-127792196 TGAAGGGAGATGAGAAGGCAAGG - Intergenic
1091133291 11:133165022-133165044 TCAAGGGAAATGAAATCCATGGG - Intronic
1091414686 12:271175-271197 GCATGGGAGAAGAGAACCATGGG - Intergenic
1091921214 12:4306456-4306478 TCAAGGGGAATGGGAACAAAGGG - Intergenic
1093134578 12:15435651-15435673 TCAAGAGAAAGAAGAACCAATGG - Intronic
1095632224 12:44391772-44391794 TGAAGGCAGATGAGAAACAATGG - Intergenic
1095713500 12:45315912-45315934 GCAATGGAGATGAGAAGTAAGGG - Intronic
1096840062 12:54374618-54374640 TCAGGGAAAATGAGACCCAAGGG - Intronic
1100838709 12:98591150-98591172 TCAAAGGAGATGCGGCCCAAGGG + Intergenic
1102210135 12:111120600-111120622 TCAAAGGAGTTGAGGACAAAGGG - Intronic
1103453452 12:121046142-121046164 TCAAGGGAGTTAACACCCAATGG - Intergenic
1104378932 12:128290296-128290318 TCATGGGAAATGGGAAGCAAGGG + Intronic
1104688876 12:130809334-130809356 TAAAGGGAAAGGAGAAACAAGGG + Intronic
1106090419 13:26587681-26587703 TCATGGGAGAAGACAATCAAGGG + Intronic
1107464626 13:40638270-40638292 TCAAGCCAGATGAGAACCTCTGG + Intronic
1109053958 13:57522131-57522153 ACTAGGGAGAAGAGAAACAAGGG + Intergenic
1110012109 13:70349588-70349610 TCAAGTTAAATGACAACCAATGG + Intergenic
1110013081 13:70363893-70363915 TCAAGAGAAAAGACAACCAATGG - Intergenic
1111674152 13:91366562-91366584 AGTAGGGAGATGAGAACCAATGG - Intergenic
1112041701 13:95553424-95553446 TCAAGGGAGGTCAGGACAAACGG - Intronic
1114671983 14:24416323-24416345 TCAAGGGAGATAAGAAGCCCAGG + Exonic
1115855966 14:37630077-37630099 TAAAATGAGATCAGAACCAAAGG - Intronic
1117215864 14:53550979-53551001 TTGAGGGAGATTAGAACCAATGG - Intergenic
1117503423 14:56376523-56376545 AGAAGGGAGAAGAGAACCAAGGG + Intergenic
1120829357 14:88984467-88984489 TAAAAGGAGAAGAGAATCAAAGG + Intergenic
1124623950 15:31297560-31297582 ACATGGGTGATGACAACCAAGGG + Intergenic
1124689877 15:31812843-31812865 TCAAGGGTCCTGAGGACCAAGGG - Intronic
1126779932 15:52130763-52130785 TCAAAGGAGGTTAGAAGCAAAGG + Intronic
1126809988 15:52392699-52392721 TGAATGGAGATGAGAAGCAATGG - Intronic
1128294266 15:66504666-66504688 GAGAGGGAGATGAGGACCAAAGG - Intronic
1128750999 15:70148862-70148884 TCCAGGGCAATGGGAACCAAGGG + Intergenic
1129260140 15:74361596-74361618 TCAAAGGAGACGTGACCCAAGGG - Intronic
1130235650 15:82131041-82131063 TCATGGGAGGTGTGAACAAATGG + Intronic
1133398619 16:5468343-5468365 TGAAGGGAGAGGAGAACAACAGG - Intergenic
1136864713 16:33737710-33737732 TCTAGGGTGAAGAGAATCAATGG - Intergenic
1141282814 16:82644381-82644403 TTAAGGGACCTGAGAATCAAAGG - Intronic
1203126208 16_KI270728v1_random:1585846-1585868 TCTAGGGTGAAGAGAATCAATGG - Intergenic
1142949748 17:3468861-3468883 GCAAGGATGATGAGAACCAGGGG - Intronic
1143365867 17:6408120-6408142 TCAAGGGAGCTGGGAAACACAGG + Intronic
1144467331 17:15506911-15506933 TCAAAGGAGATGCGGCCCAAGGG - Intronic
1145787389 17:27603130-27603152 TCCAGGAAGACCAGAACCAAAGG - Intronic
1146447937 17:32947780-32947802 TAAAGGGAGCAGAGAAACAAAGG - Intergenic
1152118143 17:78401365-78401387 TCAAGGGAGCTGGGAGCCACAGG - Intronic
1152359706 17:79826020-79826042 TCAGGGGATGTCAGAACCAAGGG + Intergenic
1153100258 18:1460242-1460264 TCAAGGGATATGAAATCCAGTGG - Intergenic
1153768228 18:8395074-8395096 TTAAAGGAGATGAGAAACAAAGG + Intronic
1156422161 18:36966460-36966482 ACAAGGGAGATGAGAAGGGAGGG + Intronic
1157190958 18:45581189-45581211 GAAAGGGAGATGAGAACAGAGGG + Intronic
1158131915 18:54161639-54161661 TCAAGAGAGAAGAAAATCAATGG - Intronic
1159221554 18:65470968-65470990 TCATTGGAGCTGAGAACAAATGG - Intergenic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1162770083 19:12944146-12944168 TCAAGAAAGATGAGAACCAGGGG - Exonic
1164838414 19:31373990-31374012 TCCAGGAAGAGGAGAACCAGTGG - Intergenic
1165387554 19:35519803-35519825 TCAAGGTAGCTGAGATGCAAAGG + Intergenic
1166036016 19:40169151-40169173 TCAGGTGAGTTGAGAACTAATGG - Intergenic
1167427990 19:49439403-49439425 GCCAGAGAGATGAGAACCCAAGG - Intronic
1167430861 19:49453630-49453652 TCAAGGGGCAAGAGAACCAGTGG - Intronic
1167688618 19:50971501-50971523 CCAAGGGAGATGGGGACCCAGGG - Intergenic
1167979291 19:53259465-53259487 TCACGGCACATGAGAACAAAAGG - Exonic
1168369382 19:55819359-55819381 TCAAGGGAAAAGATAACCAAGGG - Intronic
927462284 2:23309681-23309703 ACAAGGGAGATCAGAGCCCAGGG + Intergenic
929042865 2:37762536-37762558 TCAAGGGAGGTAAGATCCAGGGG + Intergenic
934034624 2:88078560-88078582 TGAGGGGAGATGGGAACCAGAGG + Intronic
934088291 2:88528818-88528840 TCTCTGGAGATGGGAACCAAGGG + Intronic
934800628 2:97154129-97154151 TCTAGGGTGAAGAGAATCAATGG + Intronic
935210787 2:100938208-100938230 TCAAGGGAGAGGACAACAGATGG + Intronic
935440985 2:103095044-103095066 TCCAGGGAGTTGAGCAGCAATGG - Intergenic
936485331 2:112920486-112920508 TCAAGTGAGATGATACCCATGGG + Intergenic
936602817 2:113915706-113915728 TCAATAGTGATGAGATCCAATGG - Intronic
939119697 2:138101512-138101534 TCAAGGGAAATGACAGCCAAGGG - Intergenic
941128838 2:161621314-161621336 TCAAGGGATAAGAGATACAAAGG + Intronic
944034328 2:195275481-195275503 TTAAGGGAGATGAAATTCAAGGG + Intergenic
944935336 2:204561571-204561593 ACAAGGGAGATGAGTACATAGGG - Intronic
945221014 2:207484509-207484531 TCAATGAATATCAGAACCAACGG + Intergenic
1171147381 20:22797151-22797173 GCAAGGGAGATGAGAAGAAGTGG - Intergenic
1171279562 20:23884246-23884268 TCAAGGGTGATCAGACCCCAAGG - Intergenic
1171364098 20:24611773-24611795 TCAAAGGAGATCAGCACCATGGG - Intronic
1171937407 20:31288014-31288036 TCAAGAGAGAAGAGTAGCAAAGG - Intergenic
1174377772 20:50137907-50137929 TAAAGGGACATGACAACTAAAGG + Intronic
1174547220 20:51334552-51334574 TCAAGGGAGGTGAGTGGCAACGG + Intergenic
1175868354 20:62193696-62193718 TCAACAGAGATGAGACCCAGAGG - Intronic
1177170294 21:17647814-17647836 CCAAGGGAGAAGAGGGCCAAGGG - Intergenic
1177590053 21:23151905-23151927 ACAGGGGACATGAGAAACAATGG + Intergenic
1178865306 21:36321819-36321841 GGAAGGGAGAAGAGAATCAAAGG - Intronic
1178967489 21:37135564-37135586 TGAATGCAGAAGAGAACCAAGGG + Intronic
1179309916 21:40186220-40186242 TCAAGGCAGCTGGGAACCACAGG - Intronic
1180203171 21:46239527-46239549 TCAACAGAGATGACCACCAAAGG + Intronic
1180282301 22:10713526-10713548 TCAAGGGACATGAGAAGAGAGGG + Intergenic
1181634967 22:24170241-24170263 TTAAGGGAGGAGAGAACCAGAGG - Intronic
1181644307 22:24222631-24222653 CCAAGGGAGCTGAGAACCTTAGG + Intronic
1182391455 22:30000658-30000680 TCCAGGGAGTTGAGAACCCAGGG + Intronic
1182862875 22:33575764-33575786 ACAAAGGAGAAGTGAACCAAGGG + Intronic
1184233775 22:43172246-43172268 CCAAGGGAGATGGGCTCCAAGGG + Intronic
1184745162 22:46451912-46451934 CAGAGGGAGATGAGAAGCAAGGG + Intronic
1203295053 22_KI270736v1_random:34032-34054 TCAAGGGAGATAAGATCCAGGGG + Intergenic
950174290 3:10861765-10861787 TCAAGTGAGGTGAGAACAAGAGG + Intronic
952552902 3:34499054-34499076 GGAAGGAAAATGAGAACCAAAGG + Intergenic
952944469 3:38468371-38468393 TCAAGGGGGTTGAGAACTAGGGG + Intronic
953179306 3:40581734-40581756 CAAAGGGAGGTGAGAACCACAGG - Intergenic
955544746 3:60016365-60016387 TCACAGTAGATGAAAACCAAAGG + Intronic
956809324 3:72848932-72848954 ACAAGGCAGGTGAGAACTAAGGG - Intronic
958685741 3:97390804-97390826 ACAAGGGTGATGAGAAAGAATGG + Intronic
960180968 3:114577405-114577427 TAAAGAGAGATAAGAATCAAAGG + Intronic
961388463 3:126537703-126537725 TCCAGGGAGTTGACACCCAACGG - Intronic
961582315 3:127892756-127892778 TTAAGGGAGATGATAATAAAAGG + Intergenic
962394894 3:135006984-135007006 TGAATGGAGGTGAGACCCAATGG + Intronic
965267763 3:166568557-166568579 GCAAGGGAGACTAAAACCAAAGG - Intergenic
966757503 3:183385298-183385320 ACCTGGGAGGTGAGAACCAAGGG - Intronic
968472218 4:787340-787362 TCACGGGAGATGAGAAACGCGGG - Intronic
969622986 4:8288111-8288133 TCAAGGGAGAGGAGATTTAATGG + Intronic
970562031 4:17291599-17291621 CCAAGAGACATGAAAACCAATGG + Intergenic
973529169 4:51818341-51818363 CCAAGGGAGATGATAATAAAAGG - Intergenic
973660667 4:53103214-53103236 TGAAGGGAGATGATTAGCAAAGG + Intronic
973909784 4:55567799-55567821 TAAAGGGAGATCATATCCAAAGG + Intronic
976085255 4:81401158-81401180 TCAAAGGGGCTGAGAACCACTGG - Intergenic
976480491 4:85538158-85538180 TGAAGTGAGATAAGAAACAAGGG + Intronic
976912727 4:90327267-90327289 TCAAAGGAAATGAACACCAATGG - Intronic
977382717 4:96296827-96296849 TCATGGTATATGAGAAACAATGG + Intergenic
978071905 4:104483371-104483393 CCAAGAAAGATGAGAAACAAAGG - Intronic
978362042 4:107940781-107940803 TAAAGGAAGATGAGAAGGAAGGG + Intronic
978693221 4:111541554-111541576 TCAAGGGTGATGAGGTCCACAGG - Intergenic
979317470 4:119281240-119281262 TCAAGGAAGATGATTAGCAAAGG + Intronic
980113849 4:128660333-128660355 TTAAAGGATATGAAAACCAAGGG + Intergenic
982766033 4:159349678-159349700 TCAAGGGAAGTGAGAATAAAGGG - Intronic
983907570 4:173199842-173199864 TTAGGGTAGATGAGAACCACAGG + Intronic
984003053 4:174274092-174274114 TAAAAAGAGATGAGAACCAGTGG - Intronic
984211569 4:176856036-176856058 TCAGGGGAGATGTGTACCAGGGG - Intergenic
985780068 5:1865829-1865851 CCCGGCGAGATGAGAACCAAGGG - Intergenic
985980009 5:3454567-3454589 TGAAGGGAAATAAGAAGCAAAGG + Intergenic
986475249 5:8123425-8123447 TCAAGGGAGATAATAAACATTGG - Intergenic
988098641 5:26650215-26650237 TCAAGGGAGAAGACACTCAAGGG - Intergenic
988252542 5:28778505-28778527 TCAAAGGGGTTGAGAATCAAAGG + Intergenic
990797267 5:59557855-59557877 TCAGGGAAAATGAGAACCTATGG + Intronic
992101567 5:73412637-73412659 TCAAGGGAGAGCAAAACTAAAGG - Intergenic
994150271 5:96439760-96439782 TGGAGGGAGGTGAGAAACAAAGG - Intergenic
994942359 5:106341083-106341105 TGAAGGAAGAAGAGAACCAAAGG - Intergenic
998279870 5:140795859-140795881 TCAGGGGAAATCAGAACTAAGGG + Exonic
998413411 5:141928261-141928283 ACAAGGGAGATGAGAAGAAACGG - Exonic
998610730 5:143685302-143685324 TTTATGGAGATGAGAACCATTGG + Intergenic
999822008 5:155237762-155237784 GCAAGGGAGATGAGAATTCATGG - Intergenic
1003221339 6:4163619-4163641 TCAAGGCTGCTGACAACCAAGGG - Intergenic
1005319396 6:24637842-24637864 TCAAGGGAAATCAGAACCCCAGG + Intronic
1005355198 6:24976464-24976486 TCAAAGGAGATGCGGCCCAAGGG - Intronic
1005421011 6:25651200-25651222 CTTAGGGAGATGAGAACTAATGG + Intergenic
1007117972 6:39357184-39357206 TCAAGAGACATGAGAGCCACAGG + Intronic
1007500506 6:42293356-42293378 TCAAGGGAGATGAGAACCAAAGG + Intronic
1007623862 6:43231329-43231351 CCAAGTGAGATGGGAACCACTGG - Intergenic
1008279475 6:49578845-49578867 TACATGGAGATGAGAAACAAAGG - Intergenic
1009928292 6:70146379-70146401 TCAAAGGAGATGAAAAACAAAGG - Intronic
1010528671 6:76939163-76939185 TCAAGGAAGATGTAAACAAATGG + Intergenic
1010665932 6:78629756-78629778 TCCAGGGAGCTGAGCAGCAATGG - Intergenic
1011211520 6:84960542-84960564 TCAAGGATAATGATAACCAAGGG - Intergenic
1011523630 6:88238952-88238974 TCAATGGAAATGAGCACTAAAGG + Intergenic
1013531562 6:111024004-111024026 TAAAAGAAGATGTGAACCAAAGG + Intronic
1014074764 6:117223428-117223450 CCAAGGGAAATGTTAACCAAGGG - Intergenic
1015880480 6:137866659-137866681 ACAATGGAGATGGGGACCAAAGG + Intergenic
1016215311 6:141593124-141593146 TGAAGGGAGATGAGAGGGAAAGG - Intergenic
1018061040 6:160089929-160089951 TCTGGGGACATGAGGACCAATGG + Exonic
1018869222 6:167768772-167768794 TCAGGGGAGGTGGGAACCAGAGG + Intergenic
1021258000 7:18418073-18418095 TCCTGAGAGATGAGAAACAAAGG - Intronic
1021542993 7:21781360-21781382 TCAAGGGCGATTTGAACCACTGG + Intronic
1021627493 7:22608772-22608794 CCAGGGGAGTTGACAACCAAGGG - Intronic
1022570179 7:31445010-31445032 GCAAGGGAAATGAGAAAAAAAGG - Intergenic
1024109902 7:46134435-46134457 AAAAGGGAGAAGAGAACCAATGG + Intergenic
1024302500 7:47897926-47897948 TCCAGGGCGATGAGAAGCATGGG + Intronic
1025932869 7:66010468-66010490 TGCAGGGAGTTGAGAAGCAAGGG - Intergenic
1025950515 7:66141781-66141803 TGCAGGGAGTTGAGAAGCAAGGG + Intronic
1027964021 7:84982307-84982329 TGAAGGGTGATAGGAACCAAAGG - Intergenic
1030196086 7:106855145-106855167 CCAAAGGAAATGAAAACCAAAGG - Intergenic
1030889907 7:114986643-114986665 TGAGGGGAGAGGAGAAACAAAGG - Intronic
1032059637 7:128713929-128713951 TCCAGGGAAATGCAAACCAAAGG + Intronic
1032708615 7:134443455-134443477 TCAAAGGATAAGAGAAGCAACGG + Intronic
1032741563 7:134744755-134744777 TCAAGGAAGAGCAGAAACAAAGG - Intronic
1032861553 7:135884644-135884666 TCAAAGGAGAAGAGTCCCAATGG - Intergenic
1035068539 7:156124702-156124724 CCCAGGGAGCTGAGCACCAAAGG - Intergenic
1036391750 8:8329963-8329985 ACACAGGAGCTGAGAACCAATGG + Intronic
1039288042 8:36064032-36064054 TCAAGAGAGATGGGAAGCCATGG + Intergenic
1041123678 8:54612662-54612684 TTAAGTGAGATGAGAAACCAAGG - Intergenic
1041592934 8:59610920-59610942 TCAAAGGATATGAGAAAGAATGG - Intergenic
1042341459 8:67684455-67684477 GCAAGGGAGGTGAGAACTTAAGG - Intronic
1043827621 8:84948563-84948585 TCAGGGCAGATGTGAACCAGTGG - Intergenic
1044834372 8:96281462-96281484 TCCAGGGAGGTGGGAACCACTGG - Intronic
1045453153 8:102348861-102348883 TCAAGTGAGAGGAGAAACCATGG - Intronic
1046145721 8:110155910-110155932 AGAAGGTATATGAGAACCAAAGG - Intergenic
1046280915 8:112030271-112030293 GCAAGGGAGAAGAGACACAAAGG + Intergenic
1046818948 8:118615777-118615799 GCAAGGCAGATGAGAAAGAAAGG + Intronic
1049050213 8:140188756-140188778 TCAAGAGAGAAGAGGAGCAAAGG - Intronic
1050186884 9:2984022-2984044 TCAAGTGAGATGAGGACACATGG + Intergenic
1050303168 9:4279852-4279874 TAAAGAGATATGACAACCAAAGG + Intronic
1051400028 9:16671043-16671065 TCAAGGGAAATGAGAGCCAATGG + Intronic
1051649614 9:19308449-19308471 TCACAGGAGAGGAAAACCAAGGG - Intronic
1052505459 9:29348534-29348556 TAAAGGGAGATAACAAACAAGGG + Intergenic
1052759682 9:32577757-32577779 TCAAGGGAGATGAGCATCTGTGG + Intergenic
1054159131 9:61661338-61661360 TTGAGGGAGATGGGAATCAAAGG + Intronic
1054478905 9:65592343-65592365 TTGAGGGAGATGGGAATCAAAGG + Intergenic
1055793279 9:79946725-79946747 TCAATGGATATGAAAACCAATGG - Intergenic
1055824891 9:80311875-80311897 TCATGAGAGATGAGTACCCATGG - Intergenic
1055920883 9:81459728-81459750 CCAAGGGAGCTGTGAATCAAAGG - Intergenic
1057838531 9:98466476-98466498 TCATGTGAGATGAGGAGCAATGG - Intronic
1059457351 9:114407907-114407929 ACCAGGGAGAGCAGAACCAAAGG + Intronic
1060014262 9:120072724-120072746 TGAAGGGACAAGAGAACCCAAGG + Intergenic
1061052910 9:128206585-128206607 GCATCTGAGATGAGAACCAAGGG + Intronic
1061453955 9:130683840-130683862 TCCAGTGGGAGGAGAACCAAAGG - Intergenic
1061668295 9:132173363-132173385 TCAAGGGAAGTCAGAAGCAAGGG - Intronic
1186304192 X:8237081-8237103 TCAAGGGAGAAAAGATCAAAGGG - Intergenic
1187208272 X:17203610-17203632 AGAAGGGAAATGAGAAGCAAAGG - Intergenic
1188237877 X:27751599-27751621 TCAAGAAAGATGACAACCAGGGG + Intergenic
1188399318 X:29725399-29725421 ACAAGGGACATGATACCCAAGGG - Intronic
1189646635 X:43140055-43140077 TCAAGGGTGGTGAGAATCCATGG + Intergenic
1190120212 X:47652813-47652835 TTAAGTGAGATGGGAGCCAAGGG + Intronic
1191897910 X:66013207-66013229 TGAAGGGAGATGAGAAAGAAGGG - Intergenic
1192947741 X:75984184-75984206 TCCAGGGAAATGATAACCATAGG - Intergenic
1194338075 X:92673895-92673917 TGATGGGAGGTGAGAACTAATGG + Intergenic
1196814536 X:119654370-119654392 ACAGGGGAGATGAGAACAAGAGG - Intronic
1199922647 X:152425434-152425456 TAAAGAGATATGATAACCAAAGG - Intronic
1200646477 Y:5790630-5790652 TGATGGGAGGTGAGAACTAATGG + Intergenic