ID: 1007503053

View in Genome Browser
Species Human (GRCh38)
Location 6:42313241-42313263
Sequence CTGAGTCATCTGAAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007503048_1007503053 10 Left 1007503048 6:42313208-42313230 CCCAAGGAACGTCTTCAAGAGAA 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1007503053 6:42313241-42313263 CTGAGTCATCTGAAGCAGAGAGG 0: 1
1: 0
2: 0
3: 19
4: 196
1007503049_1007503053 9 Left 1007503049 6:42313209-42313231 CCAAGGAACGTCTTCAAGAGAAG 0: 1
1: 0
2: 1
3: 8
4: 144
Right 1007503053 6:42313241-42313263 CTGAGTCATCTGAAGCAGAGAGG 0: 1
1: 0
2: 0
3: 19
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007503053 Original CRISPR CTGAGTCATCTGAAGCAGAG AGG Intronic
902840843 1:19072885-19072907 CTGAGCCACATGAAGCAGCGAGG + Intergenic
904478315 1:30778351-30778373 GTGAGGCAACTGAGGCAGAGAGG - Intergenic
904740048 1:32667351-32667373 TTCAGGCAGCTGAAGCAGAGAGG - Intronic
905323940 1:37137214-37137236 GTGAGTCATCTGGAGCAAAGAGG + Intergenic
905369710 1:37476565-37476587 CTGACTCAGCTGAAGCAGCCTGG + Intronic
905943798 1:41885112-41885134 CTGAGTTATGTGAAGCTCAGAGG - Intronic
906137556 1:43510188-43510210 CTGAGTCATCTCCAGAAGGGCGG + Intergenic
906928301 1:50142565-50142587 TTTTCTCATCTGAAGCAGAGTGG - Intronic
907489825 1:54801623-54801645 CTGACTCAGCTCAAGCAGACAGG - Intergenic
907544497 1:55247787-55247809 TTGAGTGATTTTAAGCAGAGGGG - Intergenic
907544633 1:55249121-55249143 CTGAGTGATTTTAAGCAGAGGGG - Intergenic
911037668 1:93567638-93567660 CTGAGTTATCTGCAGCACTGTGG - Intronic
911177413 1:94830970-94830992 CTGAGAAAACTGATGCAGAGAGG + Intronic
911994414 1:104746203-104746225 ATGATTCAGCTGAAGTAGAGTGG - Intergenic
912301482 1:108521034-108521056 GTGGGTGAGCTGAAGCAGAGTGG - Intergenic
912400155 1:109384171-109384193 CTGAGGCATCTGAATCATGGAGG - Intronic
914705996 1:150170357-150170379 TGGTGTCATCTGTAGCAGAGAGG + Intergenic
915345117 1:155193318-155193340 CCGGGTCCACTGAAGCAGAGCGG + Intergenic
915554757 1:156655181-156655203 TTGGGTCATCTGAACCAGAAAGG + Intronic
918992175 1:191711324-191711346 CTGAGTATTCTTAAGCAGAGGGG - Intergenic
919664913 1:200282697-200282719 CTGACTCACATGAGGCAGAGAGG + Intergenic
921281383 1:213571432-213571454 CTGGGTCTTGGGAAGCAGAGAGG + Intergenic
924425811 1:243949290-243949312 CAAAGTTATGTGAAGCAGAGAGG - Intergenic
1065825456 10:29566718-29566740 CTGAGTCAGAAGAAGCAGAGAGG - Intronic
1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG + Intergenic
1068227740 10:54128270-54128292 CTGAAGCATGTGAAGAAGAGAGG - Intronic
1068900525 10:62264739-62264761 TAGAATCATCTGAGGCAGAGAGG + Intronic
1070630905 10:78083917-78083939 CAGAGTCTTCTGAAGCCAAGAGG - Intergenic
1071952831 10:90724375-90724397 CTGAGTCATATGTGGCAGAAGGG - Intergenic
1072394356 10:95023472-95023494 GAGAGTGAGCTGAAGCAGAGTGG - Intergenic
1073058826 10:100720501-100720523 ATGAGGCAGCTGAGGCAGAGAGG - Intergenic
1073854095 10:107655266-107655288 TAGAGACATCTGCAGCAGAGGGG + Intergenic
1074482476 10:113837175-113837197 CAGAGTCATTTGAAGAAGTGTGG - Exonic
1077051020 11:566987-567009 CTGAGTGATCTGAAGCACTCTGG - Intergenic
1079659867 11:23023500-23023522 CTGAGTCATTTTATGTAGAGAGG + Intergenic
1079873127 11:25824876-25824898 CTGAGTCAGAGGATGCAGAGAGG - Intergenic
1081695176 11:45104705-45104727 CTGTGTCATCTGCAGCACTGAGG - Intronic
1082716449 11:56619869-56619891 CTGAGGCATCTGTAGAACAGGGG - Intergenic
1083966261 11:66045677-66045699 CTAAGTTATCTGGAGCAGTGAGG - Intronic
1085057343 11:73413163-73413185 CTGAGTCATCAGGGGCAGGGGGG - Intronic
1085109510 11:73875179-73875201 CTGAGTGTTCTGATGCAGACGGG - Intronic
1088368767 11:109066338-109066360 CTGAGAAATCTGAAGCAAAGAGG + Intergenic
1088804572 11:113340468-113340490 CTGAGGCCTCTGACGCTGAGAGG + Intronic
1088866478 11:113852529-113852551 CAGAACCATCTGAAGTAGAGGGG - Exonic
1089078881 11:115760177-115760199 CCGGGTCATCAGAAGCACAGTGG + Intergenic
1089082365 11:115787510-115787532 CTGAGTCATGACAAGCAGAGAGG - Intergenic
1090272129 11:125394316-125394338 CTGAGCCATCCTAAGCAAAGAGG - Intronic
1093849443 12:24017965-24017987 CTGAGTTAACGGGAGCAGAGTGG - Intergenic
1095430142 12:42125322-42125344 CTGAGGCATTTGAATCAGAAAGG + Intronic
1097218961 12:57435590-57435612 ATGAGGCATCTGGAGGAGAGGGG - Intronic
1097894202 12:64808108-64808130 AGGAGCCATCTGAAGGAGAGAGG - Intronic
1098159718 12:67638404-67638426 TTCATTCATTTGAAGCAGAGGGG + Intergenic
1098806482 12:75026155-75026177 TTTAGTCATCTGAACAAGAGGGG + Intergenic
1101269506 12:103128958-103128980 CTGAGGCATATGATACAGAGAGG + Intergenic
1101785515 12:107879714-107879736 CTGAGTCATCTGATGCCATGAGG + Intergenic
1101787827 12:107901144-107901166 CTGAGTGTTTTTAAGCAGAGTGG - Intergenic
1103188138 12:118979628-118979650 CTGAGTCACTTGCAGGAGAGAGG - Intergenic
1103202314 12:119097802-119097824 GTGAGTTATCTGAAGTACAGGGG - Intronic
1104516422 12:129431322-129431344 CTGGAAAATCTGAAGCAGAGAGG - Intronic
1106402967 13:29447430-29447452 CTGATTCATCTGTAGCTGATTGG + Intronic
1106666982 13:31861955-31861977 CTCTGTCTTCTGAAGCAGAGAGG + Intergenic
1107066322 13:36217364-36217386 ATAAGTCATCTGAAGCCTAGAGG + Intronic
1107479842 13:40776964-40776986 ATGAGTCATCTTACGTAGAGGGG - Intergenic
1107883122 13:44851033-44851055 ATGAGTACCCTGAAGCAGAGTGG - Intergenic
1107911474 13:45109247-45109269 CTCAGTAATCTGAAGAGGAGAGG - Intergenic
1108447407 13:50523420-50523442 GTGAGTCAACTGAGTCAGAGAGG - Intronic
1109453265 13:62546675-62546697 CAGATACATTTGAAGCAGAGAGG + Intergenic
1110729402 13:78862594-78862616 GTGAGTCATCTGTAACATAGGGG - Intergenic
1111311409 13:86491458-86491480 CTGATTCATTGGAAGCAGTGGGG - Intergenic
1111426589 13:88092697-88092719 CTGAGCCACCTGAAGCTGGGGGG + Intergenic
1111571376 13:90091097-90091119 ATTAGTCATCTTAAGCAGAGTGG + Intergenic
1114365535 14:22023368-22023390 CTGAGGCCTCAGAAGAAGAGAGG - Intergenic
1115521238 14:34234899-34234921 CTTACTCCTCTGAACCAGAGAGG + Intronic
1118316951 14:64731347-64731369 CTGAATCTCCTGCAGCAGAGGGG - Exonic
1118549448 14:66933515-66933537 CTGAGGCATGTGAAGCAATGTGG + Intronic
1118905047 14:70017724-70017746 CTGGGGCATCTGAAGAAAAGGGG + Intronic
1119465979 14:74858966-74858988 CTGAGGAAACTGAGGCAGAGAGG - Intronic
1121510980 14:94513382-94513404 CTCAAGAATCTGAAGCAGAGCGG + Intronic
1121885691 14:97540649-97540671 CTGATCCATGTGAAGCAGAAAGG - Intergenic
1122138454 14:99647862-99647884 CTGTGTCCTCTGGAGGAGAGAGG + Intronic
1122452918 14:101825771-101825793 CAGTGTCATCTTCAGCAGAGGGG + Intronic
1122630596 14:103106002-103106024 CTGAGTCCCCTGAGGCACAGAGG - Intronic
1124259083 15:28171395-28171417 CTGAGTAATTTGAACCAGAAAGG + Intronic
1124566595 15:30820785-30820807 CTGAGTAATTTGAACCAGAAAGG - Intergenic
1124923362 15:34047616-34047638 CTGAGTCAACTGAACCACAGAGG - Intronic
1125717349 15:41826903-41826925 CTGACTTACCTGCAGCAGAGGGG - Exonic
1127732473 15:61813569-61813591 CCGAGTCACCAGAAGCACAGAGG - Intergenic
1128347247 15:66862276-66862298 GGGACTCATCTGAATCAGAGTGG + Intergenic
1129332962 15:74837181-74837203 GTGAGCCATCTGGAGCAGAGGGG - Exonic
1129799598 15:78404090-78404112 ATGAGGAAGCTGAAGCAGAGAGG - Intergenic
1130145205 15:81268859-81268881 CTGAGGAAACTGAGGCAGAGAGG + Intronic
1132703053 16:1230109-1230131 CAGCGTCACCTGGAGCAGAGTGG - Intronic
1132705269 16:1240759-1240781 CAGCGTCACCTGGAGCAGAGTGG + Intronic
1132708397 16:1256122-1256144 CAGCGTCACCTGGAGCAGAGTGG + Exonic
1133841605 16:9415254-9415276 CTGAGCCATCTGAAAAAGATGGG + Intergenic
1138158456 16:54729136-54729158 CAGAGTCAGATGTAGCAGAGGGG - Intergenic
1139107988 16:63851483-63851505 ATGAGCCACCTAAAGCAGAGAGG + Intergenic
1139680246 16:68555916-68555938 CTGAGTTAGCTGGAGCAGTGAGG - Intronic
1140680454 16:77379790-77379812 CTGACTCATCTTAAACAGATAGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1143111945 17:4557965-4557987 CAGAGTTATCTGAAGCATGGGGG - Exonic
1144775686 17:17783520-17783542 CTGAAACATCTGTTGCAGAGGGG + Intronic
1145405314 17:22585175-22585197 CTGAGCCATTTGCAGCAGAGAGG - Intergenic
1145843155 17:28013446-28013468 CTTAGTCACCTGAAGGAGACGGG + Intergenic
1146057145 17:29587189-29587211 CTGTGGCATCTCAGGCAGAGAGG - Intronic
1146588868 17:34110438-34110460 CTGAGGCAGCGGCAGCAGAGAGG - Intronic
1147162901 17:38578366-38578388 GGGAGGCATCTGGAGCAGAGAGG - Intronic
1151143294 17:72016031-72016053 ATGAGGCATTTGAAGCAAAGAGG + Intergenic
1156763847 18:40627281-40627303 CTGATTCATCTGTAGTAGATGGG + Intergenic
1157378818 18:47192178-47192200 GTGAGTCATCTGAAGCAACAAGG - Intergenic
1157401712 18:47394161-47394183 CTGAGGCACCTGGAACAGAGTGG + Intergenic
1157580350 18:48770608-48770630 CTGGGCCATCTGGAGCAGACAGG + Intronic
1157713929 18:49869493-49869515 CTAAGTCAACAGCAGCAGAGTGG + Intronic
1158210080 18:55039372-55039394 CTCAGACATGTGAAGTAGAGTGG + Intergenic
1159966709 18:74601893-74601915 ATGAGTCATTTGGAGCAGAAAGG + Intronic
1163022926 19:14493157-14493179 CTGAGCCATCTGTACCACAGGGG - Intronic
1166045109 19:40225391-40225413 CTGGGTGCTCTGAGGCAGAGGGG - Intronic
1166459238 19:42971611-42971633 CAGAGGCATTTGAACCAGAGTGG + Intronic
1166476184 19:43126880-43126902 CAGAGGCATTTGAACCAGAGTGG + Intronic
925640269 2:5980583-5980605 CTGAGTGAATGGAAGCAGAGTGG - Intergenic
925828004 2:7869302-7869324 CTAAGTCATCTGGGGCAGTGGGG - Intergenic
928197904 2:29228318-29228340 CAGAGCCTTCTGAAGCTGAGAGG - Intronic
933294046 2:80470007-80470029 CAGAGTCCTCTGAATGAGAGAGG - Intronic
933599143 2:84312288-84312310 GTGACTCTTCTGAAGCAGGGGGG - Intergenic
934952800 2:98590314-98590336 CTGCCTAATTTGAAGCAGAGGGG + Exonic
935374153 2:102378292-102378314 ATGAGGAATCTGAGGCAGAGAGG - Intronic
935756297 2:106278593-106278615 CTGTGTTCTCTGGAGCAGAGAGG - Intergenic
940359700 2:152783878-152783900 CTGACTCTTGTGAAGCAGAGAGG - Intergenic
941751849 2:169142571-169142593 CTGGGTCCTTTGCAGCAGAGTGG - Intronic
944420644 2:199526394-199526416 CTGAGCCACCTGGAGCAGACTGG + Intergenic
947490785 2:230592784-230592806 AGCAGTCATCTGAGGCAGAGGGG - Intergenic
1170309572 20:14977569-14977591 CTGAGGAAACTGAGGCAGAGAGG - Intronic
1172489427 20:35323177-35323199 ATGACTCATCAGAAGCAGAAAGG - Intronic
1172895232 20:38295547-38295569 CTTGGTGATGTGAAGCAGAGGGG + Intronic
1172949789 20:38715569-38715591 ATGAGTAAACTGAAGCAGAGAGG + Intergenic
1175520602 20:59600231-59600253 ATGCCTCATCTGGAGCAGAGAGG - Intronic
1179613437 21:42566709-42566731 CTGCTTCATCTGCAGCAGAAAGG - Intronic
1179726966 21:43346257-43346279 CTGAGTCACGTGCAGCTGAGCGG + Intergenic
1181345143 22:22214627-22214649 CTCAAAGATCTGAAGCAGAGAGG - Intergenic
1183393173 22:37557266-37557288 CTGGGTAAGCTGAGGCAGAGAGG - Intergenic
1184552083 22:45209896-45209918 CTGAGGAATTTGGAGCAGAGGGG - Intronic
949407697 3:3732005-3732027 TTGAGTCATCTTAAGCAGGTAGG - Intronic
951409049 3:22340019-22340041 CTGAGTTTTATGAAGCAAAGAGG - Intronic
957791594 3:84948815-84948837 CTGAGTCATTAGAATCAAAGTGG + Intergenic
964123849 3:153215676-153215698 CTTAGTCAACAGAAACAGAGAGG + Intergenic
964897964 3:161621233-161621255 CTGAGTCCTGTGAAGAAAAGAGG - Intergenic
967882725 3:194313334-194313356 CTGAGTTTTATGAAGCAGATAGG + Intergenic
967971781 3:195004729-195004751 CTGAGACATATGAATCTGAGGGG - Intergenic
969281463 4:6173464-6173486 CTTGGTCACCTGAGGCAGAGTGG - Intronic
971300084 4:25434692-25434714 CTGAGTAAACTGAGGCTGAGTGG + Intergenic
973305428 4:48643269-48643291 CTGAGTCCTCTGTAGCTTAGAGG + Intronic
973745112 4:53956493-53956515 CTGAGTTAGCTGAATCTGAGTGG - Intronic
974083630 4:57237179-57237201 CTGAGGAATCTGAGGCACAGAGG + Intergenic
979090916 4:116481143-116481165 CTGAGTCACCTGAAGTAGAATGG + Intergenic
980334130 4:131446805-131446827 CAGAGTCATGTGAAGGAGATTGG - Intergenic
981325168 4:143438152-143438174 TGGAGTCAACTGAAGCAGATGGG - Exonic
981634248 4:146857488-146857510 TTGAATCATCTCAAGCTGAGTGG + Intronic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
982395340 4:154909859-154909881 CTGAGTCATCTTTAGGAGTGAGG - Intergenic
984129882 4:175861382-175861404 CTGAGTCATTTAAATGAGAGAGG - Intronic
985016722 4:185643647-185643669 CTGAGTCCACTGCAGGAGAGGGG + Intronic
985706522 5:1404571-1404593 CAGAGTCATCTGAACGAGACTGG + Intronic
987588660 5:19893129-19893151 CTGTGTCCTCAGAGGCAGAGGGG - Intronic
989300293 5:39883756-39883778 CTGAGTTAGCTGGAGTAGAGAGG - Intergenic
990009788 5:50983041-50983063 CAGAGGCAACAGAAGCAGAGAGG - Intergenic
990011688 5:51006242-51006264 CAAAGTCATCTGGAGCAGAATGG + Intergenic
991246368 5:64512492-64512514 TTGAGGAAACTGAAGCAGAGAGG - Intronic
992611755 5:78514034-78514056 CTGAGACATCTGTATCAAAGGGG + Intronic
993147960 5:84120502-84120524 CTGTGTCATCTGAAGGAGTAAGG - Intronic
994424600 5:99569018-99569040 CTGAGTGATCTGAAGTACAATGG + Intergenic
994935800 5:106252029-106252051 CTAAGTCATCTGAATAAGAGTGG + Intergenic
995751204 5:115455091-115455113 GTGAGGCATCTGAAGCTGAGAGG - Intergenic
999274118 5:150317508-150317530 CTGAGTCATCCGAATCCCAGTGG - Intronic
999811890 5:155135431-155135453 CTGAAGCATCTGTATCAGAGAGG + Intergenic
1000311032 5:160044842-160044864 CAGAGGCATCTGAATCAAAGTGG - Intronic
1000786440 5:165550046-165550068 CAGGGTGAGCTGAAGCAGAGTGG - Intergenic
1004444557 6:15686135-15686157 ATGAGACATGTGCAGCAGAGCGG - Intergenic
1006643522 6:35500704-35500726 CTGAGACATCTAAATCAGATGGG - Intronic
1007503053 6:42313241-42313263 CTGAGTCATCTGAAGCAGAGAGG + Intronic
1012439064 6:99245422-99245444 CAGAGTCATGTGCTGCAGAGTGG - Intergenic
1018341635 6:162857079-162857101 CTGAGTCATTTGCAGCGGGGTGG + Intronic
1021399268 7:20191135-20191157 ATGAGGCATTTCAAGCAGAGGGG + Intronic
1021633962 7:22673106-22673128 CTCAGTGATGTGGAGCAGAGAGG - Intergenic
1021648843 7:22813026-22813048 CAGACGCATCTGTAGCAGAGTGG - Exonic
1022960095 7:35418112-35418134 CAGTGTGATCTAAAGCAGAGAGG - Intergenic
1022965332 7:35466738-35466760 CTGAGGCCTCCCAAGCAGAGTGG + Intergenic
1024962634 7:54993762-54993784 TGGAGTGATCTGAAGCAGGGTGG + Intergenic
1026562372 7:71461061-71461083 CAGAGGCATCTGAACTAGAGCGG - Intronic
1026908619 7:74079282-74079304 CTGAGTGAGCTCACGCAGAGTGG + Intergenic
1028904625 7:96139193-96139215 ATGATTCATCTGAAGCACAGGGG + Intronic
1032469978 7:132171123-132171145 CTGAGTAATTTGAAGGACAGCGG - Intronic
1032694814 7:134325809-134325831 ATGAATCATATGAAGCAGATAGG + Intergenic
1034091839 7:148370928-148370950 CGGTGTCATGTGAAGCAGACTGG - Intronic
1035476640 7:159148822-159148844 CTGAGGCATGAGAGGCAGAGTGG - Intergenic
1036023084 8:4870832-4870854 TGGATTCATCTGAAGCAGAGGGG - Intronic
1037888576 8:22608627-22608649 CTGTGTCATCTGTAGCATTGGGG + Intronic
1039789705 8:40865507-40865529 CTGAGGGTTCTGGAGCAGAGAGG - Intronic
1042059978 8:64806037-64806059 CTGTGTTCTCAGAAGCAGAGAGG - Intergenic
1044514231 8:93120145-93120167 CTGCGTAATGTGAAGAAGAGAGG - Intergenic
1045670381 8:104544850-104544872 CTGATTCATGGGCAGCAGAGTGG - Intronic
1045694852 8:104797389-104797411 CTGAGTCATTTCAGGCAGAATGG + Intronic
1046534844 8:115496034-115496056 TTGAGCCATGAGAAGCAGAGGGG - Intronic
1046841815 8:118867028-118867050 TTCTGTCATCTCAAGCAGAGTGG + Intergenic
1047860934 8:128965911-128965933 CTGAGTCCTCTCCAGCACAGTGG - Intergenic
1056216087 9:84407450-84407472 CTGATTCAACTAAAGTAGAGCGG + Intergenic
1057194716 9:93110613-93110635 CTGAGCCACCTGCAGCGGAGCGG + Exonic
1058111360 9:101033762-101033784 CTGAAGCAGCTGAAACAGAGAGG + Intronic
1060201122 9:121652177-121652199 CTGAGTAAACTGAGGCACAGTGG - Intronic
1061165126 9:128917767-128917789 CCGAGTGATCTAAAGCAGGGTGG - Exonic
1062090099 9:134671567-134671589 CTGAGTCAGCAGAGCCAGAGAGG + Intronic
1062313499 9:135953116-135953138 CTGAGTTTTCTGAGACAGAGAGG - Intronic
1186185818 X:7018745-7018767 CAGAGGCATTTGAACCAGAGTGG + Intergenic
1187259673 X:17673657-17673679 AGGAGTCATGTGAATCAGAGAGG - Intronic
1188237584 X:27748645-27748667 CTGCGTCACGTGACGCAGAGAGG + Exonic
1190711935 X:53077731-53077753 CTGTGTCATGTGAAGCAGGCTGG + Exonic
1201131441 Y:10954795-10954817 CTGAGTGGAGTGAAGCAGAGTGG - Intergenic