ID: 1007506924

View in Genome Browser
Species Human (GRCh38)
Location 6:42342731-42342753
Sequence CAGCCAAGACTGTTGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007506924 Original CRISPR CAGCCAAGACTGTTGAAGAC AGG (reversed) Intronic
906530965 1:46523798-46523820 GAGCCAGGCCTGTTGAAGTCTGG + Intergenic
909761184 1:79289300-79289322 CAGCCAAGAATCTGGAAGAGTGG + Intergenic
910851918 1:91657098-91657120 CATCCAAAATTGTTGAAGGCAGG + Intergenic
917431562 1:174974852-174974874 CAGCCCAGTCTGCTGAGGACTGG - Intronic
920039856 1:203088553-203088575 AAGCCAAAACTGCTGAAGACTGG + Intergenic
921972598 1:221166443-221166465 CAGCAATGGCTGTTGAAGGCCGG - Intergenic
924878522 1:248131913-248131935 CAGGCTAGACTATTGAAGAAAGG + Intergenic
1068513655 10:57998303-57998325 CTGCCAAGACTGGTGAAGTAGGG + Intergenic
1069016267 10:63432580-63432602 ATGCCAGGGCTGTTGAAGACTGG - Intronic
1078020640 11:7653619-7653641 CAGCCAAGACTGTGGTCCACGGG - Exonic
1078269848 11:9785124-9785146 CATCCAAGAATGATGAAAACAGG - Exonic
1079083783 11:17431199-17431221 CAGCCAAGACTGGGCAGGACAGG - Intronic
1086219231 11:84421283-84421305 CAGCCCAAACTGATTAAGACAGG + Intronic
1092228379 12:6763839-6763861 AAGCCAAGACTTCAGAAGACTGG + Intronic
1093305137 12:17507568-17507590 AAGCCCAGACTGTTCCAGACAGG - Intergenic
1094306372 12:29024217-29024239 CAGCCTGGATTGTTGAAGACTGG + Intergenic
1097048146 12:56203378-56203400 CAGCAAATACTTATGAAGACTGG + Exonic
1101260528 12:103025061-103025083 AAGCCAAGACAGTGGCAGACAGG + Intergenic
1103493974 12:121346565-121346587 CAGCCCAGACTTATGAAGAGAGG - Intronic
1105264499 13:18803979-18804001 CAGCCAAGACAGTGGGAAACTGG - Intergenic
1106867555 13:33983148-33983170 CAGCAGAGTCTGTGGAAGACTGG - Intergenic
1117518861 14:56530313-56530335 CAGCAGAGACTGTGGAAGGCTGG - Intronic
1118681432 14:68245750-68245772 AAACCAAGACTGTTCAAGATTGG + Intronic
1120348838 14:83326918-83326940 CAGCCCAGACTGATTAAGGCAGG + Intergenic
1120498455 14:85264161-85264183 CAGCTAATACTGTAGAAGAATGG - Intergenic
1122738200 14:103855712-103855734 CAGCCAACACTTGTGAAAACAGG - Intergenic
1129443568 15:75600226-75600248 CTGACAAGACTGTTGAGGACTGG + Intronic
1129461167 15:75700697-75700719 CAGCAGAAACTGCTGAAGACAGG + Intronic
1129843154 15:78756124-78756146 CCGCCAAGACTGCTGACGGCTGG + Intergenic
1130253423 15:82315031-82315053 GGGCCAAGAGTGCTGAAGACAGG - Intergenic
1131716674 15:95119071-95119093 AACCCAAGTCTGTTGGAGACAGG - Intergenic
1132870826 16:2115070-2115092 CAGGCAGGACAGTTGCAGACCGG + Intronic
1134521703 16:14921834-14921856 CAGGCAGGACAGTTGCAGACAGG - Intronic
1134709373 16:16320485-16320507 CAGGCAGGACAGTTGCAGACAGG - Intergenic
1134716586 16:16360514-16360536 CAGGCAGGACAGTTGCAGACAGG - Intergenic
1134950228 16:18348160-18348182 CAGGCAGGACAGTTGCAGACAGG + Intergenic
1134958164 16:18391645-18391667 CAGGCAGGACAGTTGCAGACAGG + Intergenic
1135486932 16:22873925-22873947 CAGGCAAGCCTGCTGAAGAATGG - Intronic
1135749321 16:25044301-25044323 CAGCCAACACTACTGAAGACAGG - Intergenic
1144404881 17:14942604-14942626 CAGCCAAGAATGTGGCAGAGTGG - Intergenic
1145878146 17:28335368-28335390 CAGCCCAGGCTGATGTAGACAGG + Exonic
1149401586 17:56301951-56301973 TTGCCAAGACTGTTGAAGAGTGG - Intronic
1151454108 17:74215808-74215830 CAGTCAAGCTTGCTGAAGACTGG - Intronic
1154423894 18:14257582-14257604 CAGCCAAGACAGTGGGAAACTGG + Intergenic
1154957918 18:21277228-21277250 CAGCCCAGCCTTTTGAATACAGG + Intronic
1156294683 18:35778745-35778767 CAGCTGAGACTGCTGAAGAAGGG - Intergenic
1158965871 18:62621841-62621863 CACCCAAAACTGATGTAGACGGG + Intergenic
1161755593 19:6131260-6131282 CAGCCAAGACTCTGGGAGAGTGG + Intronic
1166634988 19:44443181-44443203 AAGCCAAGAGTGTTGCAGATGGG + Intronic
925344004 2:3157181-3157203 CAGCCAAGTCTGTCGAACAGAGG + Intergenic
927663723 2:25014906-25014928 CAGCCAGGACTGTAGAAGAGGGG - Intergenic
928952085 2:36822186-36822208 CAGCCAAGACTGTCCCAGAGGGG + Intergenic
931864878 2:66398775-66398797 CAGCCAAGACTTTATAAGAAAGG + Intergenic
931904113 2:66823752-66823774 CAGCTAAGGATCTTGAAGACAGG + Intergenic
933262716 2:80148290-80148312 CAGCAAAGACTGCTGAGTACAGG + Intronic
933582645 2:84144738-84144760 CAGCAGAGACTGTTGCAGAAGGG + Intergenic
937720244 2:125086647-125086669 CAGCCAAGACTGTTAACCATAGG - Intergenic
938571775 2:132568105-132568127 CAGCCAAGACTGAAGATCACTGG + Intronic
938684945 2:133729136-133729158 CAGCCAATCCTGTGGAACACAGG + Intergenic
942665092 2:178309029-178309051 CAGACAAGACTGTTGAGGTTGGG - Intronic
946889606 2:224261678-224261700 CAGCCAATACTTTTGCAGAGTGG - Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170001335 20:11617965-11617987 CAGCCATTACTGTTGAGTACAGG + Intergenic
1170122841 20:12928730-12928752 CAGCCAGAGCTGATGAAGACAGG - Intergenic
1170274614 20:14570891-14570913 CAGCCAAGAATGATGTAGCCTGG + Intronic
1174094757 20:48079250-48079272 CAGCCAAGGCTGTGGATGGCAGG + Intergenic
1176081994 20:63278152-63278174 CGGACAAGGCTTTTGAAGACTGG + Exonic
1176849575 21:13902426-13902448 CAGCCAAGACAGTGGGAAACTGG - Intergenic
1177681223 21:24374148-24374170 CAGCCAAGAATTTTGTATACAGG - Intergenic
1182005240 22:26954376-26954398 CAGCCAAGACTCTCAAAGAGTGG + Intergenic
949780241 3:7678500-7678522 CAGCCTACACTGTTCAAGAAAGG - Intronic
950035799 3:9884613-9884635 GAGCCATGACTGTTGAAGGGAGG - Intergenic
950243145 3:11389787-11389809 CTGCCAAGACTTATGACGACAGG - Intronic
955166931 3:56524070-56524092 CAGCCCAAACTGATTAAGACGGG + Intergenic
961837440 3:129674777-129674799 CAGCAAAGGCTGTTGAAAAAGGG - Intronic
963617740 3:147563884-147563906 CAGCACAGAAGGTTGAAGACAGG + Intergenic
965519948 3:169662058-169662080 CCGCCAGGACTGTAGACGACAGG - Intronic
966243064 3:177775998-177776020 CAGCCAAAAATGTAGAATACAGG + Intergenic
968132441 3:196199345-196199367 CAGCAAAGGCTCTTGAAGTCAGG - Intronic
968764600 4:2461711-2461733 CAGACAAGAGTGGTGGAGACAGG + Intronic
969143185 4:5097976-5097998 CGGCCAAGGCTGTTATAGACTGG - Intronic
969185167 4:5469264-5469286 AAGCCAAAACGGTTGAATACTGG - Intronic
969947146 4:10795596-10795618 CAGCCAAGAATTTTGTATACAGG - Intergenic
972020075 4:34301512-34301534 CAGTCAAGACTGCTTAAGTCAGG + Intergenic
974436344 4:61862080-61862102 CAGACAAGATTGTAGAAGAAAGG + Intronic
975339681 4:73225540-73225562 CAGGCAACACTGTTGAAAGCAGG + Intronic
977101797 4:92825506-92825528 CAGACAAGACTGCAGAAGCCTGG - Intronic
979854936 4:125620236-125620258 CAGGCAACACTGTTTAAGACTGG + Intergenic
983216914 4:165010571-165010593 CAGCCAAGACTGTTGGATGCAGG - Intergenic
983222848 4:165059260-165059282 CAGCCAGGACTGTTGGATGCAGG - Intergenic
985379558 4:189378095-189378117 CAGCCAACGCTGTTGAAGGTGGG + Intergenic
988806334 5:34744159-34744181 CAGACAAGACACTTGGAGACAGG - Intronic
990190985 5:53260079-53260101 CAACCAAACCTGTTGATGACTGG + Intergenic
991273218 5:64811134-64811156 CAGCCAAGGTTGATGAAAACTGG + Intronic
993250766 5:85519259-85519281 GAGCCAAGACTGCTGAGGACTGG - Intergenic
994409560 5:99389614-99389636 AAGCCAAGACAGATGATGACTGG + Intergenic
1003502248 6:6712311-6712333 CACACATTACTGTTGAAGACTGG + Intergenic
1004451580 6:15752913-15752935 CAGCCCAGACTGAGGCAGACTGG + Intergenic
1007506924 6:42342731-42342753 CAGCCAAGACTGTTGAAGACAGG - Intronic
1008399754 6:51051157-51051179 CTGCCAAGACTGTTCATGAATGG + Intergenic
1012113935 6:95269850-95269872 CTACCAACACTGTTGAAAACTGG + Intergenic
1015036529 6:128662033-128662055 CAACCAAGACTGATGAAGTTAGG - Intergenic
1018710268 6:166493858-166493880 CAGCCAGCACTGTTGAGGTCGGG - Intronic
1018747933 6:166776899-166776921 TACCCAAGATTGTTGAAAACAGG - Intronic
1019489528 7:1305682-1305704 CAGCCAAGGCAGACGAAGACAGG + Intergenic
1020339819 7:7098064-7098086 CAGCTAAGCATGTTCAAGACCGG + Intergenic
1020431461 7:8120429-8120451 AAGCCAAGACAGTTGAAATCTGG - Intronic
1021335948 7:19402747-19402769 CAACCAATACTTTGGAAGACTGG - Intergenic
1022570837 7:31452686-31452708 CAGCCAGGACTGCTGGGGACTGG + Intergenic
1023914185 7:44576199-44576221 CAGCCAAACCTGTTGAAGGCTGG + Intergenic
1024665450 7:51542639-51542661 CAGCCAAGAATGTTGTATCCAGG - Intergenic
1028235474 7:88356140-88356162 GAACCAAGAGTGTTGAAGGCAGG + Intergenic
1028462244 7:91107505-91107527 TATCCAAGCCTGTTGATGACTGG + Intronic
1029248719 7:99221023-99221045 CAGTCCAGGCTGCTGAAGACAGG - Intergenic
1031090270 7:117346523-117346545 CAGCCAAGAATTTTGCATACAGG - Intergenic
1033340999 7:140492215-140492237 CAGCTAAGACAGTGGAAGAGGGG - Intergenic
1033426928 7:141253105-141253127 GAGCCAAAACTGTGGAAGAGAGG - Intronic
1034156510 7:148959954-148959976 CAGCTGAGCCTGTGGAAGACAGG + Intergenic
1043609672 8:82046485-82046507 CAGGCCAGCCTGTTTAAGACTGG + Intergenic
1049745202 8:144260360-144260382 CAGCCTACACTGTCGAAGAAAGG - Exonic
1052792284 9:32886821-32886843 CAGCCAAGACCCTTGAAGAAGGG + Intergenic
1057464824 9:95303464-95303486 CAGCCTAAACTGACGAAGACAGG - Intronic
1057808940 9:98242733-98242755 CAGCCATGACTGGTGGAGCCAGG + Intronic
1059806011 9:117801309-117801331 CAGCCAGGATTGATGAACACTGG - Intergenic
1061083778 9:128387447-128387469 CAGCCATGGCAGTTGGAGACTGG + Intronic
1188028587 X:25237795-25237817 CAGCCAGGAGAGTTGAAGAGTGG + Intergenic
1190493577 X:51006205-51006227 CAGTCAAGACTGGTCTAGACTGG - Intergenic
1195883884 X:109620383-109620405 GAGTCTAGACTTTTGAAGACAGG - Intergenic
1197323030 X:125056912-125056934 GAGTCAAGTCTGTTGAAGACAGG - Intergenic
1197690096 X:129490115-129490137 CTGACAACACTGTTGAAGAGAGG - Exonic
1198069116 X:133130463-133130485 CAGCCAAGACAGATGAAGAAAGG + Intergenic
1198610591 X:138395574-138395596 AAGCCATGTCTTTTGAAGACTGG + Intergenic