ID: 1007512138

View in Genome Browser
Species Human (GRCh38)
Location 6:42381761-42381783
Sequence TGGGCTCTGCTTCTCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 355}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007512138_1007512152 21 Left 1007512138 6:42381761-42381783 CCTCCTGGGAGAAGCAGAGCCCA 0: 1
1: 0
2: 3
3: 31
4: 355
Right 1007512152 6:42381805-42381827 TTCAAGCACAGGAGGGCTCAGGG 0: 1
1: 0
2: 1
3: 17
4: 153
1007512138_1007512141 -10 Left 1007512138 6:42381761-42381783 CCTCCTGGGAGAAGCAGAGCCCA 0: 1
1: 0
2: 3
3: 31
4: 355
Right 1007512141 6:42381774-42381796 GCAGAGCCCACCCCAGACTTGGG 0: 1
1: 0
2: 1
3: 14
4: 246
1007512138_1007512149 13 Left 1007512138 6:42381761-42381783 CCTCCTGGGAGAAGCAGAGCCCA 0: 1
1: 0
2: 3
3: 31
4: 355
Right 1007512149 6:42381797-42381819 GAGAAGTATTCAAGCACAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 207
1007512138_1007512148 10 Left 1007512138 6:42381761-42381783 CCTCCTGGGAGAAGCAGAGCCCA 0: 1
1: 0
2: 3
3: 31
4: 355
Right 1007512148 6:42381794-42381816 GGGGAGAAGTATTCAAGCACAGG 0: 1
1: 0
2: 0
3: 13
4: 143
1007512138_1007512150 14 Left 1007512138 6:42381761-42381783 CCTCCTGGGAGAAGCAGAGCCCA 0: 1
1: 0
2: 3
3: 31
4: 355
Right 1007512150 6:42381798-42381820 AGAAGTATTCAAGCACAGGAGGG 0: 1
1: 0
2: 0
3: 49
4: 288
1007512138_1007512153 24 Left 1007512138 6:42381761-42381783 CCTCCTGGGAGAAGCAGAGCCCA 0: 1
1: 0
2: 3
3: 31
4: 355
Right 1007512153 6:42381808-42381830 AAGCACAGGAGGGCTCAGGGAGG No data
1007512138_1007512151 20 Left 1007512138 6:42381761-42381783 CCTCCTGGGAGAAGCAGAGCCCA 0: 1
1: 0
2: 3
3: 31
4: 355
Right 1007512151 6:42381804-42381826 ATTCAAGCACAGGAGGGCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 149
1007512138_1007512142 -9 Left 1007512138 6:42381761-42381783 CCTCCTGGGAGAAGCAGAGCCCA 0: 1
1: 0
2: 3
3: 31
4: 355
Right 1007512142 6:42381775-42381797 CAGAGCCCACCCCAGACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007512138 Original CRISPR TGGGCTCTGCTTCTCCCAGG AGG (reversed) Intronic
900169608 1:1260198-1260220 TGGGCTTCGCCTCTCCCTGGTGG - Intronic
901195792 1:7439132-7439154 CAGGCCCTGCTGCTCCCAGGTGG + Intronic
901799638 1:11700696-11700718 TGGGCTCCGGTTCTCCCCGTGGG + Intronic
903545672 1:24121977-24121999 TGGGCTCTGGTTTCTCCAGGAGG + Intronic
904539895 1:31225754-31225776 TGGGCTATGCCCCTCTCAGGTGG + Intronic
905397256 1:37674707-37674729 TGGGCTCTGCTCTACCCAGTGGG - Intergenic
907126354 1:52054657-52054679 ACGGCTCTATTTCTCCCAGGTGG + Intronic
908709719 1:67001587-67001609 TTGCCTCTTTTTCTCCCAGGAGG + Exonic
912957436 1:114165442-114165464 TAGGCTCTCCTCCTCCCAGGTGG + Intergenic
913410053 1:118541769-118541791 GGGGCATTGCATCTCCCAGGGGG + Intergenic
915022191 1:152790609-152790631 TGTACTCTGCTAATCCCAGGTGG - Intronic
915092276 1:153434893-153434915 AAGGCTCTGCCTCTCCCTGGGGG + Intergenic
915758778 1:158290089-158290111 CTAGCTCTTCTTCTCCCAGGTGG + Exonic
915891798 1:159780679-159780701 CGGGCTCTGCTGCACCCTGGCGG - Intergenic
915982253 1:160427638-160427660 TGTCCTCTGCTTCTCCCCTGTGG + Exonic
916196948 1:162233349-162233371 GTGGCTCTGACTCTCCCAGGAGG + Intronic
916294861 1:163206714-163206736 TGCTCTCTGCTTCTCCAAGATGG - Intronic
917580099 1:176368238-176368260 TGGGCTCTGGTCTTCCGAGGTGG + Intergenic
917640092 1:176975062-176975084 TGGGCTAAGCTTCTCCCATGTGG - Intronic
918251700 1:182708734-182708756 TGAGCTCTGATTCCCCCATGCGG - Intergenic
918414095 1:184289215-184289237 TGTGCTCTGCTGCTCCAAGTAGG - Intergenic
920021755 1:202961674-202961696 AGAGCTCCGCTTCTCCCTGGAGG - Intergenic
921671185 1:217925400-217925422 TTGGCTCTTCTAATCCCAGGTGG + Intergenic
922187179 1:223286062-223286084 TAGTCCCAGCTTCTCCCAGGTGG - Intronic
924037332 1:239950564-239950586 TGAGCTCTGCTTCTCCCAGCAGG + Intergenic
924151636 1:241135709-241135731 TGGGAACTCCTTCTCCCACGTGG + Intronic
1063009631 10:2009812-2009834 TGAGCCCTGCTTCTTCCTGGTGG + Intergenic
1063371554 10:5525782-5525804 TCAGCTCTGCTTCTCCCGAGTGG - Exonic
1064343304 10:14506787-14506809 TGGTCCCTGCTTCTCCTTGGGGG - Intergenic
1066631738 10:37465189-37465211 CAGCCTCAGCTTCTCCCAGGAGG - Intergenic
1069617318 10:69814304-69814326 GGGGCTCTGAGTTTCCCAGGAGG + Intronic
1069993357 10:72328472-72328494 AGGACTCTGCTTCCCCCCGGAGG + Intergenic
1070957973 10:80476923-80476945 AGGGCTGTGCTTCTCTCTGGAGG + Intronic
1071415749 10:85439659-85439681 TGACCTCTGCTTCTCCCATCAGG - Intergenic
1073122559 10:101131568-101131590 TGGGCTCTGCGTGACCCGGGTGG - Exonic
1074315760 10:112360363-112360385 TGGGCTCTACTTCTCCCCCAGGG + Intergenic
1076124337 10:127962477-127962499 TGGTCTCTGCTTCCCCGGGGAGG - Intronic
1076138015 10:128058251-128058273 TGGGCCCGGCCTCTTCCAGGTGG - Intronic
1076534441 10:131167718-131167740 TGGGCCCTGGTTTTTCCAGGGGG + Intronic
1076639255 10:131902464-131902486 TAGGCCCTGTTTGTCCCAGGGGG - Intronic
1076741926 10:132489990-132490012 TGGGGCCTGCCTCTCCCCGGAGG - Intergenic
1077096498 11:801311-801333 CAGCCTCTGGTTCTCCCAGGAGG + Exonic
1081964353 11:47160665-47160687 CTGCCTCTGCTTCTCCAAGGAGG - Intronic
1083147082 11:60767742-60767764 TGGGCACAGCCTCTCCTAGGTGG + Intronic
1083682234 11:64356997-64357019 TGAGATCTGCTTCCCTCAGGAGG - Intronic
1084051463 11:66602889-66602911 TAGCATCTGCTTTTCCCAGGTGG + Intronic
1084301256 11:68254128-68254150 TAGGCTCTGCTTTCCCCAAGGGG - Intergenic
1085029019 11:73258468-73258490 TGAGCTCTGGTTCTCCCAGCTGG - Intergenic
1088836038 11:113578557-113578579 TGGGGTCTGCTTCTGCCTGAGGG - Intergenic
1088896301 11:114081131-114081153 TGTTCTCTGCTTCTACCAAGGGG + Intronic
1089257525 11:117201714-117201736 TTGGCTCTGCTTCCCGCGGGTGG + Intronic
1089535897 11:119160680-119160702 TGGCCTCTGCTCCTCCCTGGAGG + Intronic
1090090894 11:123696802-123696824 AGGGCGCTAATTCTCCCAGGAGG - Intergenic
1090213422 11:124939289-124939311 TGGGCTATGCTGCTCCGAAGAGG - Intergenic
1090609378 11:128456548-128456570 TGGCCTCTGCTTTTCCCCAGGGG - Intergenic
1091300373 11:134503454-134503476 TGGGCCCTGCTGCTTCCCGGAGG + Intergenic
1091400168 12:176478-176500 TGCTCACTGCCTCTCCCAGGAGG - Exonic
1091617271 12:2059146-2059168 TGGGCTCCCCATCTCCCAGCTGG - Intronic
1091977596 12:4837909-4837931 TGGGCTCTGCAGCTCAGAGGTGG + Intronic
1092182193 12:6453427-6453449 TGTGCCCTGCTTCTCCCCAGTGG + Exonic
1093972060 12:25384641-25384663 TGGGCTCACCTTCTCTCAGCTGG + Intergenic
1094493576 12:30976122-30976144 TGGGCCGGGCTTCTCCCAGGGGG + Intronic
1094851229 12:34383241-34383263 TGGGCCCTGCTTATGCCCGGTGG + Intergenic
1096838152 12:54364334-54364356 TGGTCTCCTCATCTCCCAGGTGG - Exonic
1097224702 12:57470592-57470614 TCGGCTCGGCTTCTCCAAGGAGG - Exonic
1102668614 12:114598458-114598480 TTGGCTTTGCTCCTCCCTGGAGG + Intergenic
1102910440 12:116709499-116709521 TGGACTCAGTTTCTCCCGGGAGG - Intergenic
1103722927 12:122984171-122984193 TGGGCTCAGCCTCTCCCCAGGGG - Exonic
1103993521 12:124814787-124814809 TGGGTTCTGAGTTTCCCAGGTGG - Intronic
1104390762 12:128389031-128389053 TGGTCTTTGTCTCTCCCAGGGGG - Intronic
1104947878 12:132424938-132424960 AGGGCTCTGCCTCTCCAATGAGG - Intergenic
1105213340 13:18270821-18270843 ATGGCTCTGCTGCTCCCACGGGG + Intergenic
1105439381 13:20402814-20402836 TATGCTCTCCTTCTCCCAGAAGG + Intergenic
1106092577 13:26610441-26610463 TGGGCTTTGGTTTTACCAGGGGG + Intronic
1106796831 13:33215286-33215308 TGGGCTCTGCTCTGCCCAGCCGG + Intronic
1107730078 13:43339762-43339784 TCAGCTTTCCTTCTCCCAGGTGG - Intronic
1108179275 13:47824918-47824940 TGGGCTTTGCTCTTCCCAGGTGG - Intergenic
1109309645 13:60677473-60677495 TGGTCACTGCTTCTCCCTTGAGG + Intergenic
1112349207 13:98618863-98618885 TGCCCTCTGCTTCTCCCAGAGGG - Intergenic
1118315129 14:64721498-64721520 TGGGCCCTGCTGCTCTTAGGTGG + Intronic
1118821583 14:69349465-69349487 TGTGCCCCTCTTCTCCCAGGAGG + Intronic
1119241229 14:73061594-73061616 TGGGGTCTCTTTCACCCAGGTGG + Intronic
1119407540 14:74407848-74407870 TGCCTTCTACTTCTCCCAGGGGG - Exonic
1119609391 14:76048825-76048847 TGGGCCCTGAGCCTCCCAGGAGG + Intronic
1121646781 14:95523774-95523796 TGAGCTCTGCATTTCCCAGTCGG + Intergenic
1121757854 14:96418232-96418254 TGGACTCAGCTGTTCCCAGGAGG + Intronic
1122283555 14:100638299-100638321 CTGGCTCTGCTTCTCCAAGATGG - Intergenic
1122779618 14:104138262-104138284 AGGGCTGCGCGTCTCCCAGGAGG - Intergenic
1123629711 15:22253270-22253292 TAGACTCTGCCCCTCCCAGGAGG - Intergenic
1124604377 15:31160046-31160068 GGATCTCTGCTTCTTCCAGGGGG - Intronic
1124854704 15:33376552-33376574 AGGGATCTGCCTCACCCAGGGGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126704880 15:51397535-51397557 TTGGCTCTTCTGCTTCCAGGGGG - Exonic
1127391171 15:58506187-58506209 GGGGCTCTCCTTAGCCCAGGAGG + Intronic
1127535047 15:59882374-59882396 TTGGCTCTGCTTCTCCCGATGGG - Intergenic
1127699535 15:61484759-61484781 TGGGCTCCACTGCTTCCAGGAGG + Intergenic
1129234596 15:74216434-74216456 TTGTCTCAGCTTCTCCCTGGGGG + Intergenic
1129457936 15:75685557-75685579 TGTGCAGAGCTTCTCCCAGGAGG - Exonic
1129652041 15:77497872-77497894 TGGGTTTTTCTTCTCCCAGCAGG - Intergenic
1129775652 15:78234764-78234786 TCCGCTCCGCTTCTCCCAGGAGG + Intronic
1131021643 15:89104203-89104225 GGGGCGCTGTTGCTCCCAGGTGG + Intronic
1132521613 16:392791-392813 GGGGAGCTGCTTCTCCCAGGAGG + Intergenic
1132549971 16:550322-550344 TGGGCTCTGTGGCTCCCGGGCGG - Intronic
1132559861 16:588707-588729 CGGGCTCTGCTCCTCGCCGGCGG + Intergenic
1132761068 16:1508920-1508942 TGGGCTTTGCTTCTTTCAAGGGG + Intronic
1132882410 16:2168221-2168243 TGGGACCTGGTTCCCCCAGGAGG - Intronic
1133364009 16:5196773-5196795 TGGGCAGTGGTTCTCCAAGGGGG - Intergenic
1133387661 16:5383291-5383313 TGGGCTGTGGGTCTGCCAGGAGG + Intergenic
1135296090 16:21280444-21280466 TGGGGTCTGCTTGGCCCAGAGGG - Intronic
1135892019 16:26365851-26365873 GGGGCTGTGCATCTCCTAGGAGG - Intergenic
1136171954 16:28495125-28495147 TGGGGACTGCATCTCCCAGGAGG - Exonic
1136396060 16:29993187-29993209 TGAGCTCTGCCACCCCCAGGAGG - Exonic
1137556531 16:49473837-49473859 TGGCCTCTGCCTGTTCCAGGAGG - Intergenic
1139360080 16:66392217-66392239 TGGGCTCTGTTTCCCGCGGGAGG - Exonic
1139396180 16:66640970-66640992 TTTGCTCTGGTTCTCTCAGGAGG - Intronic
1140410708 16:74738884-74738906 TGGGTTCTGCACCTCTCAGGAGG + Intronic
1140448919 16:75054354-75054376 TGGCATCAGCTTCTCCCAGCAGG - Intronic
1140487567 16:75305829-75305851 TGGGCCCTGTTTTTTCCAGGAGG + Intronic
1141358660 16:83373860-83373882 TGGTCTCTGTTCCTCCCACGAGG - Intronic
1141786958 16:86207487-86207509 AGGGCTCTTCTCCTTCCAGGTGG + Intergenic
1141973430 16:87497477-87497499 TAGACTCTGCCCCTCCCAGGAGG + Intergenic
1142105389 16:88299725-88299747 TGGGCTCTGCCTCTGCCACAGGG + Intergenic
1142304558 16:89278254-89278276 TGGGCTCTGCCTCCCCCATGAGG + Intronic
1143501483 17:7342037-7342059 TGGGCTCTGGTGGACCCAGGCGG - Exonic
1144552754 17:16255825-16255847 AGGGCTCTGGTTCTCCCAAAGGG + Intronic
1144573477 17:16415272-16415294 TGGGCTGAGCCTCTCCCTGGGGG + Intergenic
1144778145 17:17795200-17795222 TGGGGGATGCTTGTCCCAGGTGG + Exonic
1144841002 17:18185603-18185625 TGGGCTCTTCTGCAGCCAGGAGG - Intronic
1144946302 17:18971265-18971287 TGGGCTCTGGTAGGCCCAGGCGG + Exonic
1145398310 17:22512707-22512729 AGGGCTCTGCTTCCTCCAGCAGG + Intergenic
1146380034 17:32321516-32321538 TGGGCTGGGCTTCTTCCATGGGG + Exonic
1147399234 17:40169490-40169512 TGGGCTTTCCTTCTCCCCAGAGG + Intronic
1147736559 17:42642476-42642498 AGGGCTGGGGTTCTCCCAGGAGG - Intergenic
1148485346 17:47987377-47987399 TGGGCTCAGGCTCTGCCAGGCGG - Intergenic
1148573148 17:48686705-48686727 TGGGCTCAGCCTCCGCCAGGAGG - Intergenic
1149723923 17:58872716-58872738 TGGGGTCTGTGTTTCCCAGGTGG - Intronic
1152535980 17:80950609-80950631 TGGGCTCTGCTTCCCCTGCGAGG + Intronic
1152722570 17:81930078-81930100 TGAGATCTGCTGCTCTCAGGAGG - Intergenic
1152740288 17:82015724-82015746 TGGTCTCAGCCTCTCCCAGATGG - Intronic
1152783244 17:82235682-82235704 CGGGGGCTGCTTGTCCCAGGAGG + Exonic
1153588774 18:6651313-6651335 GGTGCTCTCCTTCTCCCCGGTGG + Intergenic
1154009219 18:10560982-10561004 TGGGCACTGCTTCTCTAGGGCGG + Intergenic
1154385133 18:13886452-13886474 TGGGCTCTCCTGCTCCCACATGG - Intronic
1155597169 18:27501812-27501834 TGCGCTCTTCTTCTCCCCAGTGG - Intergenic
1155885269 18:31200009-31200031 ATGGCTCAGCTTCTCCCGGGTGG + Intergenic
1158891022 18:61871749-61871771 AGGGCTCTGCAGCTCCAAGGTGG - Intronic
1159136904 18:64347468-64347490 TGGCCTCTGCTCCCCCCAGATGG + Intergenic
1160566501 18:79789573-79789595 ACGGCTCCGCTGCTCCCAGGGGG + Intergenic
1160611076 18:80085616-80085638 TGGGAACTTCTACTCCCAGGAGG - Intronic
1161501467 19:4618374-4618396 TTGTCTCTGCTCCTCCCATGGGG + Intergenic
1161776169 19:6263418-6263440 TGGGGTCTGTTTCTCGAAGGAGG - Intronic
1162031630 19:7920053-7920075 TGTGCTTTGCTTCTCGCAGAGGG - Intergenic
1162337911 19:10073025-10073047 TGGGCTCTGCCTGTCCCCTGTGG - Intergenic
1162582484 19:11539612-11539634 TGGGCTCAGCTTCTCCCAGCTGG + Intronic
1162630499 19:11923812-11923834 TGGGCTCTGCTGCCCCCTGCAGG - Intergenic
1162651292 19:12091011-12091033 TGGGCTCTGCTGCCCCCTGCAGG - Intergenic
1163362941 19:16859505-16859527 TGGGCTCAGCTTGACCCATGAGG - Intronic
1163440577 19:17320646-17320668 TGGCCTCTGCTGCTCCCCTGAGG + Exonic
1163522625 19:17800464-17800486 TGTCCTCTGCCACTCCCAGGGGG - Intronic
1163620349 19:18355986-18356008 TGGACTGTGCTTCTCCCACAGGG - Exonic
1163645173 19:18485225-18485247 TGGGCTCTCCTCTCCCCAGGAGG + Intronic
1164454202 19:28393595-28393617 TGGGGTCGGCGTCTCCCAGACGG - Intergenic
1164457489 19:28420865-28420887 TGGGTTCTGCTCATCCCTGGAGG - Intergenic
1164675161 19:30095805-30095827 TGTGCTCTGCTGTTCCCTGGAGG - Intergenic
1164687334 19:30176069-30176091 TGGGCTGCACTTCTGCCAGGTGG - Intergenic
1165008409 19:32824801-32824823 TGGCCTCTGCTTTTCCAAAGGGG - Intronic
1165421256 19:35723065-35723087 TGGGCTCTGATTCTCCCCCAGGG - Exonic
1165953264 19:39486543-39486565 TGGGCCCTCCTTCCCTCAGGTGG - Intronic
1166194782 19:41198529-41198551 TGGCCTCCGCTTCTCCTATGAGG + Exonic
1166928212 19:46284181-46284203 TGGCCTCAGCGTCTCCCAGGAGG - Intergenic
1167805472 19:51780718-51780740 GAGGCTCTGCTTCTCCCACAAGG - Intronic
925237433 2:2292063-2292085 TGGGCTCTGCTTCCCTCTGTTGG + Intronic
925331521 2:3062468-3062490 CAGGCTCTGCATCTCCCAGGTGG + Intergenic
925454882 2:4007629-4007651 TGGGCTGGGCCTCTCCCACGGGG + Intergenic
925906790 2:8544567-8544589 TGGGCTCTGCCCCTCATAGGTGG - Intergenic
926010297 2:9401333-9401355 TGAGCTCACCTTCTCCGAGGGGG + Exonic
926694755 2:15763463-15763485 TTGTCTGTGCTTCTCCCAGGAGG + Intergenic
926754432 2:16223965-16223987 TGGGCTGAGCTGCTCCCAGAAGG + Intergenic
927519486 2:23690343-23690365 TGGGCTCTGCCACCCACAGGTGG - Intronic
927667369 2:25042064-25042086 TGGGCACTGCTGCGCGCAGGGGG - Intergenic
927809489 2:26173476-26173498 TGGGCCCCGCGTCTCCCGGGAGG - Intronic
928515274 2:32039198-32039220 TGGGATCTGCTTTTACTAGGTGG - Intronic
929857898 2:45651420-45651442 GCGGCGCTGCTTCGCCCAGGAGG + Intronic
931087854 2:58853590-58853612 AGAGCTCTGCTTCTCCCTGCAGG + Intergenic
931235448 2:60408891-60408913 TCGGCTTAGCTTCTCCAAGGAGG + Intergenic
931756343 2:65377946-65377968 TGTGCTCTGCTTCTGCCTGAAGG - Intronic
933148984 2:78891492-78891514 TGGGGTCTGCTTCTTCTTGGAGG + Intergenic
933938679 2:87227581-87227603 TGGGGACTGTTACTCCCAGGAGG - Intergenic
933945302 2:87281105-87281127 CTGGCTCTGGTTCTCCCATGTGG + Intergenic
934300982 2:91775923-91775945 ATGGCTCTGCTGCTCCCATGGGG - Intergenic
935695126 2:105764536-105764558 TTGGCTCTGGTCTTCCCAGGTGG + Intronic
936334905 2:111580486-111580508 CTGGCTCTGGTTCTCCCATGTGG - Intergenic
936354456 2:111738192-111738214 TGGGGACTGTTACTCCCAGGAGG + Intergenic
936854208 2:116937073-116937095 TGAGCTCTCCCACTCCCAGGTGG - Intergenic
937275527 2:120681614-120681636 TGGGCTGGGCTTATCCCAAGGGG + Intergenic
938422401 2:131155434-131155456 GGGGCTGGGCCTCTCCCAGGGGG + Intronic
938906029 2:135836871-135836893 TGGGCACAGCTCCTCCCAGCAGG - Exonic
941987236 2:171521919-171521941 TGGGGTCTGCTTGGCCAAGGAGG + Intergenic
942040310 2:172055044-172055066 TGGGCTCTCCTACTCCCCTGAGG + Intronic
942494950 2:176530174-176530196 TGGGCTCTGCTTCTCTGGAGTGG - Intergenic
943780729 2:191820733-191820755 TGGCAGCTGCATCTCCCAGGAGG + Intergenic
945017325 2:205532976-205532998 TGTGTTCTGCTTTTGCCAGGAGG + Intronic
946195697 2:218032149-218032171 TGGGCCCTGCCCCTCCCAGGTGG - Intergenic
946576632 2:221082675-221082697 TGTGCTCTGCTTCTCCCCAAGGG + Intergenic
946766154 2:223042871-223042893 TGGTCCCTGCTTCTGCCTGGGGG - Intergenic
947161966 2:227223991-227224013 TGGGCTCTGATACTCCAAGCAGG + Intronic
947668016 2:231919179-231919201 TGGGCGCTGTTTCTCCAAGCTGG + Intergenic
947693037 2:232157466-232157488 TGGGCTTTGCTTCTTCCAAAAGG + Intronic
947711435 2:232318643-232318665 TGCCCTCTGCTTCTCCCGGCTGG + Intronic
947748703 2:232522253-232522275 TGGTCTCTGCTGCCCCCTGGCGG + Intronic
948093155 2:235312652-235312674 TGGGCTGTGCTCCTCTCTGGAGG - Intergenic
948145353 2:235704127-235704149 TGAGCCCTGCTTCTCCCACCTGG - Intronic
949035328 2:241813521-241813543 TGGGGTCTGCTTGTTGCAGGCGG - Intronic
949059605 2:241949324-241949346 TGGCGTGTGCCTCTCCCAGGCGG + Intergenic
1169077382 20:2769552-2769574 TGGGAGCTGCTTTGCCCAGGAGG - Intergenic
1169540676 20:6596170-6596192 ATTGCTCTGCTTCTCCCTGGGGG + Intergenic
1169726809 20:8743407-8743429 TGAGCTATGATTCTCCCAAGTGG - Intronic
1171490267 20:25511921-25511943 TGCTCTCAGCTTCTGCCAGGTGG - Intronic
1172013269 20:31858618-31858640 TGGGCTCTGCGGGTCTCAGGAGG + Intronic
1172971099 20:38873522-38873544 TGGGCTCAGGGTCTCTCAGGAGG + Intronic
1173092080 20:39982629-39982651 TGGGCTCAGCTGATCCCAGCTGG - Intergenic
1173310168 20:41890213-41890235 CGAGCTCTGCTTCTCCCAGAGGG - Intergenic
1173638593 20:44582767-44582789 CAAGCTCTGCTTCTCCCTGGGGG - Intronic
1175499790 20:59441691-59441713 TGAGCTCTGCTTGTACAAGGTGG - Intergenic
1175819610 20:61901654-61901676 TGGGTGCTGCTTCTCCCGGCCGG - Intronic
1175840738 20:62025513-62025535 TGGGGACAGCTTCCCCCAGGCGG + Intronic
1176012366 20:62905740-62905762 TGGGCTCTGCTTCCCGCTGATGG + Intronic
1176776813 21:13143817-13143839 TTGGGTCTGTTTCTTCCAGGCGG - Intergenic
1177318848 21:19494407-19494429 TGGGGTCTCCTTCTCCAATGTGG + Intergenic
1178336624 21:31749407-31749429 TAGGCTCTGACTCTCCCAAGGGG + Intergenic
1178744476 21:35235406-35235428 TGGGCTCTGTATTTCCAAGGCGG + Intronic
1178980266 21:37257856-37257878 TGGGCTCTGCTGCCTCCGGGTGG + Intronic
1179658139 21:42858307-42858329 TGGGCTCTCCTTCTGCCTGGAGG - Intronic
1181559961 22:23694243-23694265 AGGCCTCTGCTTCATCCAGGAGG + Intronic
1183062470 22:35344627-35344649 TGGGCTCTGCTCCTGCCTGGGGG + Intronic
1183315260 22:37133566-37133588 AGAGCCCTGCTTCTCCCAAGAGG - Intronic
1183830359 22:40415643-40415665 TGGGATCTTCTACTCCCAGCTGG + Intronic
1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG + Intronic
1184689221 22:46109954-46109976 TCACATCTGCTTCTCCCAGGTGG + Intronic
1185404993 22:50642618-50642640 AGGGCTCTGCTGGTCCCAGCTGG + Intergenic
952924743 3:38312828-38312850 TGCCCTCTGCTCCTCCCTGGTGG - Intronic
953151616 3:40330190-40330212 TGGGGTCTGCTTCTCCTGGGAGG + Intergenic
953710305 3:45264345-45264367 TGGGCTCTGCATCTCTCTGCAGG - Intergenic
953919136 3:46939943-46939965 TAGGCTCTGCTTTGCCCAGGGGG - Intronic
954003792 3:47577537-47577559 TGGGCTCAGCTTGTCGCCGGGGG + Exonic
954132132 3:48566312-48566334 TGTGGTCTTCTGCTCCCAGGAGG - Exonic
954139419 3:48597186-48597208 TAGGCTGTGTTCCTCCCAGGAGG - Intergenic
954829961 3:53412192-53412214 TGGTCTCAGCTACTCCTAGGAGG + Intergenic
954841445 3:53515243-53515265 TGTTCTCTGCTTGGCCCAGGTGG + Intronic
954938859 3:54352608-54352630 TGGGCTCTACTGCTCCCTGGGGG - Intronic
955367956 3:58327596-58327618 TGGGCTCTGCTGCTTCAAGGAGG - Intergenic
955498983 3:59565374-59565396 CTGTGTCTGCTTCTCCCAGGAGG - Intergenic
955798207 3:62659758-62659780 TGAGCTCTTCTTCACCCAGGTGG - Intronic
959871891 3:111338187-111338209 TGTTATCTGCTTCTCCCTGGAGG + Intronic
960248418 3:115425300-115425322 TGGGCTTTTCTTTTCCCAGTAGG + Intergenic
960270922 3:115673705-115673727 TGGGCTGTGCTCATCCCAGTAGG + Intronic
960531442 3:118770010-118770032 TGGCCTCTCCTGCCCCCAGGAGG + Intergenic
960802067 3:121549801-121549823 TGGGCTCTGTTGTTCCCAGCAGG - Intergenic
960944965 3:122959706-122959728 AGGGCTCTGGTTCTCCCCGATGG - Intronic
961508724 3:127388427-127388449 TGTGCTCTGCTTCTCCCGTCAGG + Intergenic
962474434 3:135742773-135742795 TGGGCTCAACTTCTTGCAGGAGG - Intergenic
962479802 3:135788463-135788485 TGGGCTCTGCACCACCCTGGGGG + Intergenic
962757002 3:138472655-138472677 TGGACTCTTCTTCTCCCCGATGG - Exonic
962808542 3:138943522-138943544 TGCAGTCTGGTTCTCCCAGGCGG - Intergenic
964637552 3:158873881-158873903 TGGGATCTGTGCCTCCCAGGAGG + Intergenic
966433791 3:179860890-179860912 TCTACACTGCTTCTCCCAGGAGG + Intronic
967648174 3:191952367-191952389 TGGGCTTGGCGCCTCCCAGGAGG + Intergenic
968003248 3:195222022-195222044 TGGGCGCTCCTGCTCCAAGGGGG + Intronic
969473126 4:7401490-7401512 TTGGCTCTGATTCTGTCAGGAGG + Intronic
970617350 4:17780894-17780916 TGGTCTGTGCTTTTCCAAGGTGG - Intronic
979931767 4:126640801-126640823 GGAGCCCTGCTTCTCCCAGGAGG - Intergenic
980802819 4:137774684-137774706 TGCTCTCTGGTTCTTCCAGGGGG - Intergenic
981491131 4:145340539-145340561 TGGGCTCTCCTGTTCCTAGGTGG + Intergenic
981491745 4:145347068-145347090 TGAACCCTGCTTCTCCCTGGCGG + Intergenic
983773787 4:171581802-171581824 TGGGTTCTGTTTTTCCCATGTGG + Intergenic
984524690 4:180844322-180844344 TGGGGTCTGCGTTTCCCAGCTGG + Intergenic
984590594 4:181613340-181613362 TGGGCTCTGCTCCCACCAGCTGG - Intergenic
984869462 4:184313679-184313701 TGTGCTCTGATTCTCCCTGATGG - Intergenic
986051540 5:4094757-4094779 GGGGCTCTGAGTCTCCCAGCGGG - Intergenic
986689962 5:10306337-10306359 CGGGCTCAGGCTCTCCCAGGAGG - Intronic
987012031 5:13776538-13776560 TGTGCTCTGCTTCTCGCCAGTGG - Exonic
992233393 5:74685028-74685050 TGGGCTCTGCTCCTACCCGAGGG + Intronic
993643616 5:90436074-90436096 TGGCCTCTTCTTCACCCAGGGGG - Intergenic
994433173 5:99695054-99695076 TGGGCTCAACCCCTCCCAGGAGG + Intergenic
995106307 5:108381221-108381243 TCGGCCCTGCTGCTCCCAGGCGG + Exonic
995534858 5:113124931-113124953 TGAGCGCTGCTCCACCCAGGAGG - Intronic
995640654 5:114253012-114253034 TCTGCTCTGCTTCTCCTTGGGGG + Intergenic
996746568 5:126851316-126851338 TGAGTTATGATTCTCCCAGGTGG - Intergenic
997582219 5:135025215-135025237 TGGGCTCTGCCTCTCCCCAGAGG + Intergenic
998348990 5:141488669-141488691 TGGGCTTTGCCTCTCCCAGAAGG + Intronic
999938506 5:156515531-156515553 TTGCCTGTGCTGCTCCCAGGTGG - Intronic
1000073114 5:157759708-157759730 TGTGCTTTTCTTCTCCCAGAAGG + Exonic
1000336916 5:160248269-160248291 TCGGCTCTGCATCTCTCAGTGGG + Intergenic
1001763082 5:174223570-174223592 AAGGCTCTGCTTCCCCCATGAGG - Intronic
1001848514 5:174942288-174942310 TGGGTCCTGCTGCTCCCAGAAGG - Intergenic
1002159553 5:177307308-177307330 TTGGCTCTGCTGCCCCCAAGGGG - Exonic
1002181740 5:177434286-177434308 TGGGCTCTGCTGGACCCACGGGG + Intronic
1002469671 5:179427894-179427916 TGTGCTCTGCAGGTCCCAGGAGG - Intergenic
1003618257 6:7674411-7674433 TGGGCTCTGCTTCACCCTTCCGG + Intergenic
1004005410 6:11633292-11633314 TGGCCTGCGCTCCTCCCAGGCGG + Intergenic
1004299400 6:14443705-14443727 CGGGGTCTGCTTCTGTCAGGTGG + Intergenic
1006078020 6:31546795-31546817 TGGTCTCTGCTGCTCCCAGGCGG - Exonic
1006257413 6:32842881-32842903 TGGGCTCTCCTTTCCACAGGAGG - Intronic
1006334938 6:33415514-33415536 TGAGCTCTGCACTTCCCAGGGGG + Intronic
1006955446 6:37866159-37866181 GGAGCTCTGTTTGTCCCAGGTGG + Intronic
1006996188 6:38263661-38263683 TGGTCTCTGCTTCTCACTGCAGG - Intronic
1007512138 6:42381761-42381783 TGGGCTCTGCTTCTCCCAGGAGG - Intronic
1009967878 6:70596192-70596214 TCAACTCTGCTTCTCACAGGAGG - Intergenic
1010838696 6:80622594-80622616 TGTGCTCTCCCTCTCCCAGAAGG - Intergenic
1013418002 6:109941468-109941490 TGGTCTCTGCATCTTCCAGCAGG + Intergenic
1014298647 6:119652432-119652454 TAGGCTCTGTTTCTACCTGGGGG - Intergenic
1014390267 6:120853539-120853561 TGTGATATGCTTCTCCTAGGAGG + Intergenic
1014989261 6:128053530-128053552 TGGGCTCTGATTTCCCAAGGTGG + Intronic
1016140721 6:140606666-140606688 TGGGCTCCTGATCTCCCAGGCGG - Intergenic
1017064430 6:150516399-150516421 AGAGCCATGCTTCTCCCAGGGGG - Intergenic
1017326405 6:153145968-153145990 TGAGCTCAGCTTCTCCTTGGAGG + Intergenic
1019134029 6:169897151-169897173 TGTCCTCTTGTTCTCCCAGGCGG + Intergenic
1019757493 7:2783565-2783587 CAGGCTCTGCTTCTCCCACCAGG + Intronic
1020246831 7:6435797-6435819 GGGGCTCTGCTGCCCCCTGGCGG + Intronic
1022354567 7:29600713-29600735 TGGACACTGCCTCTCCCTGGCGG - Intergenic
1023344443 7:39256853-39256875 TGGGCTATGTTTCTTCCTGGAGG - Intronic
1024044418 7:45577045-45577067 GGGGCTCATCTTATCCCAGGGGG - Intronic
1024151962 7:46581054-46581076 TGGGCACTGCTTTTCCTGGGAGG - Intergenic
1024248860 7:47491348-47491370 AGCCCTCTGCTTCTCCCAGCTGG + Intronic
1029158079 7:98531571-98531593 TGGGGTCTTCTTCGCCCAGAGGG + Intergenic
1029189069 7:98759266-98759288 TGGGATCTGATTCTCCCATGTGG + Intergenic
1029467740 7:100736790-100736812 TGGGCTCTGCCTCCCCCAGAGGG + Exonic
1030858747 7:114596316-114596338 TGGGCACTGCTACTCCAAGCTGG - Intronic
1031132220 7:117845678-117845700 TGGGCTGTGCTTCTCTATGGAGG + Intronic
1031522891 7:122788010-122788032 TGTGCTCTTATTCTCACAGGGGG - Intronic
1032239177 7:130148021-130148043 TGGGCTCTTCTTCCCCAAGAGGG - Intergenic
1032563934 7:132921075-132921097 TGGGTTTTGCTTCTTCCTGGTGG - Intronic
1033134741 7:138775050-138775072 TGAGCTTTGCTTCTCCAGGGTGG + Intronic
1035264768 7:157684808-157684830 CGGGCGCTGGTTCTCCCGGGTGG + Intronic
1035269011 7:157709078-157709100 TGGCTTCTGCCTCTCCCAGTGGG + Intronic
1035576897 8:713979-714001 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035576907 8:714022-714044 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035576917 8:714065-714087 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035576927 8:714108-714130 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035576937 8:714151-714173 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035576947 8:714194-714216 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035576957 8:714237-714259 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035576967 8:714280-714302 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035576977 8:714323-714345 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035576987 8:714366-714388 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035576997 8:714409-714431 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035577007 8:714452-714474 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035577017 8:714495-714517 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035577027 8:714538-714560 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035577037 8:714581-714603 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035577047 8:714624-714646 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035577057 8:714667-714689 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035577067 8:714710-714732 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035577077 8:714753-714775 TGGGATGTGCTGCACCCAGGCGG + Intronic
1035577142 8:715140-715162 TGGGATGTGCTGCACCCAGGTGG + Intronic
1035577165 8:715269-715291 TGGGATGTGCTGCACCCAGGTGG + Intronic
1035605317 8:926566-926588 TGGGCTCTGCTCCTGCTGGGAGG + Intergenic
1037882935 8:22581677-22581699 TGGGCTCTGCTTCCTGCAGCAGG + Intronic
1037938125 8:22928657-22928679 TGCTCTCTGCTTCTCAGAGGCGG + Intronic
1038117728 8:24576576-24576598 TGGGCTCTGAGTCTCTGAGGAGG + Intergenic
1038437720 8:27548043-27548065 TGGGTTGTGCTGCTCCCGGGAGG + Intergenic
1041487297 8:58393010-58393032 TCACCTCTGCTTCTCCCTGGAGG + Intergenic
1044682687 8:94798412-94798434 TGGGCTCTGCCTCTGCCTGAGGG + Intergenic
1044728006 8:95208539-95208561 TGAGCTCTGTTTCTTCCATGAGG - Intergenic
1045317083 8:101052512-101052534 TGGGCAAAGCTTCTCCCAGCAGG + Intergenic
1048317946 8:133375728-133375750 TGGGCTCTGCATCTGGCAAGAGG - Intergenic
1048661856 8:136613214-136613236 TGGGCTCTGCATCTTCGAAGAGG + Intergenic
1048850085 8:138636679-138636701 GGAGCACTGTTTCTCCCAGGTGG - Intronic
1049357207 8:142194866-142194888 GGGGCACTGCTTCTCCCCGAGGG + Intergenic
1049637042 8:143694696-143694718 ATGGCTCTGCTTCTCCCACCTGG - Exonic
1049694625 8:143977258-143977280 TGGGCTCTGCTGACCCCTGGTGG + Exonic
1054879877 9:70134086-70134108 TTGTCTCTGCTTTTCCCAGCTGG + Intronic
1056755930 9:89382115-89382137 TGGGCACTGCTGGTGCCAGGTGG - Intronic
1057342191 9:94212833-94212855 TGGGGGCTGATTCTCCCACGTGG + Intergenic
1058671889 9:107366991-107367013 TGGGTGCTCCTTCACCCAGGTGG - Intergenic
1058990946 9:110255501-110255523 AGGGCGCGGCTGCTCCCAGGAGG + Intronic
1060807095 9:126584692-126584714 GGGGCCCTGAGTCTCCCAGGGGG + Intergenic
1061149005 9:128818509-128818531 TGGGCTCTGCTGCTCCCTTCTGG + Exonic
1061808101 9:133147671-133147693 TGGGCACTGCCTCCCCCTGGTGG + Intronic
1062347940 9:136124031-136124053 TGGGGCCAGCTTCTCCCAGCAGG - Intergenic
1062607216 9:137353665-137353687 TGGGCCCTGCATTTCCCAGCGGG - Intronic
1187609502 X:20926653-20926675 TGTGTCCTGCTTCTACCAGGTGG + Intergenic
1187778014 X:22785797-22785819 CGGGCACTGCTGCTCACAGGAGG + Intergenic
1188112215 X:26206219-26206241 TGGGTTCTGCTTGTTTCAGGTGG + Intergenic
1189544668 X:42029216-42029238 TGGGCTTTGATACTCCTAGGTGG - Intergenic
1192545596 X:72010164-72010186 GGGGCACTGGTTCTTCCAGGTGG + Intergenic
1194380180 X:93181402-93181424 TGGGTGCAGCTTCACCCAGGAGG - Intergenic
1200091010 X:153635963-153635985 TGGGCCCAGCTGCCCCCAGGTGG - Intergenic
1200116195 X:153770739-153770761 AGGGCTCTTGTTTTCCCAGGTGG + Exonic
1200152842 X:153959738-153959760 TGGCCGCTGCCTCTCCCCGGAGG + Intronic