ID: 1007513336

View in Genome Browser
Species Human (GRCh38)
Location 6:42391527-42391549
Sequence CAGTCTCAGCAGATGGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007513333_1007513336 -8 Left 1007513333 6:42391512-42391534 CCAGCCTCTGGTGAACAGTCTCA 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1007513336 6:42391527-42391549 CAGTCTCAGCAGATGGCCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007513336 Original CRISPR CAGTCTCAGCAGATGGCCTC AGG Intronic
900580457 1:3406054-3406076 CAGTCTCAGCAGACACCCACTGG + Intronic
901027677 1:6287317-6287339 CAGGCCCAGCAGCTGGTCTCTGG - Intronic
901474064 1:9477028-9477050 CAGATTCAGCAGATGTCCTGAGG - Intergenic
901474086 1:9477150-9477172 CAGATTCAGCAGATGTCCTGAGG - Intergenic
902921254 1:19667046-19667068 CTGTCTCAGGATCTGGCCTCAGG + Intronic
903014583 1:20353757-20353779 GTGTCTCTGCAGCTGGCCTCCGG + Exonic
904689654 1:32284165-32284187 GAGCCACCGCAGATGGCCTCAGG + Intronic
914846775 1:151287842-151287864 CAGCCTCAGCTGGTGGGCTCAGG - Exonic
915377649 1:155411682-155411704 AAGTCTCAGGAGTGGGCCTCAGG + Intronic
915902006 1:159854416-159854438 CAGCCTAAGCAGAGGGCCCCGGG - Exonic
915936371 1:160092415-160092437 TAGTCTCAGCCGATGGCTTCGGG + Exonic
916234855 1:162576636-162576658 CAAAATCAGCAAATGGCCTCAGG + Intronic
919118965 1:193315246-193315268 TATTCTCAGAAGATGGCCTAAGG - Intergenic
922488122 1:225992337-225992359 CAGTCTGAACAGCTGGCTTCAGG + Intronic
923302517 1:232655093-232655115 CAGAATCAGCAGATGGGCTGGGG - Intergenic
1063576540 10:7266656-7266678 CAGTTTCAACAGAAGCCCTCTGG + Intronic
1067084766 10:43231903-43231925 AAGTCCCGGCAGATGGCCACTGG - Intronic
1070113305 10:73505407-73505429 CAGGCTCTGCAGATGGCATGGGG - Exonic
1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG + Intergenic
1073499797 10:103926155-103926177 CTGTGTCAGCAGAAGGCCCCAGG + Intergenic
1075024662 10:118975728-118975750 CAGGCTCTGCGGATGGCCACGGG + Intergenic
1075311960 10:121421833-121421855 GGGTCTCAGCAGGTGGACTCTGG + Intergenic
1075682483 10:124342581-124342603 CAGCAGAAGCAGATGGCCTCAGG + Intergenic
1078091528 11:8267500-8267522 CAGCCTCGGCGGATGGTCTCTGG + Intronic
1079387487 11:19993669-19993691 CAGTCTGATCACATGGCCTCTGG + Intronic
1081987272 11:47315092-47315114 CAGTCTCATCTGCTGGCCACTGG - Intronic
1084683234 11:70679335-70679357 CAGGCTCTGCAGTTGGCCTCGGG - Intronic
1085132800 11:74056147-74056169 GAGTCTCAGCAGTTGGTCACAGG - Intronic
1085494243 11:76953121-76953143 CAGTCACAGCTGATTGCCTTTGG - Intronic
1085929182 11:81060017-81060039 CAGTCACAACAGATGGCTTTGGG + Intergenic
1086420355 11:86632227-86632249 CAGCCTGAGCAGAGGGCCTCTGG + Intronic
1089369227 11:117942371-117942393 CAGTCTCAACGGCTGGCCTCGGG - Intergenic
1090039941 11:123281904-123281926 CAGTCTCAGCCCATGGACTTTGG - Intergenic
1090953619 11:131495762-131495784 GAGGCTCAGCAGAAGGCCCCAGG + Intronic
1091038006 11:132251288-132251310 CTGACTCAGCAAATGCCCTCAGG + Intronic
1091548285 12:1518932-1518954 CCGTCTTGGCAGATGGCTTCTGG + Intergenic
1095650546 12:44603906-44603928 ATGGCTCAGCAGATGGCCACTGG + Intronic
1096501526 12:52066848-52066870 CAGTCTCTGGGGATGGGCTCTGG + Intergenic
1103274579 12:119700954-119700976 CTGGCTCAGCAGAGGGCCTCTGG - Exonic
1104319897 12:127741223-127741245 CAGTCTCAGTTGATGGGCACTGG + Intergenic
1105497121 13:20939880-20939902 GAGTCTCAGCTCCTGGCCTCCGG - Intergenic
1106319524 13:28624766-28624788 GACTCACAGCAGAAGGCCTCAGG + Intergenic
1107017510 13:35719575-35719597 CAGGCTCAGCAGATGCCCCGGGG + Intergenic
1108343012 13:49516020-49516042 CATTCTAAGCAGAGGGCCTTGGG - Intronic
1112857437 13:103788222-103788244 CAGCCCCACCAGGTGGCCTCTGG + Intergenic
1114414862 14:22535323-22535345 CAGTCACAGAATATGGCCCCAGG - Intergenic
1115509639 14:34127028-34127050 CAGCTTCAGCACATGGCCTTGGG - Intronic
1115762761 14:36591652-36591674 CAGTCTCAGATTTTGGCCTCAGG + Intergenic
1116055004 14:39852762-39852784 CAGTCACAGCTAATGGGCTCAGG + Intergenic
1118163380 14:63312971-63312993 CAGTCACAGCGGATGGCCACGGG + Exonic
1119193884 14:72702759-72702781 CAGTCTGAGCAGGTGGCTTTTGG - Intronic
1119479553 14:74951043-74951065 CAGTCCTAGCAGAGGCCCTCGGG + Intronic
1121044875 14:90780530-90780552 CAGTGACAGCTGATGGCCACTGG + Intronic
1121063264 14:90937254-90937276 CAGCCTCAGCAGATGGTGGCGGG + Intronic
1122876288 14:104667119-104667141 CAATCACAGCAACTGGCCTCGGG - Intergenic
1122988682 14:105225999-105226021 GAGTCTCAGCAGATCTCTTCAGG - Intronic
1202904512 14_GL000194v1_random:60482-60504 CAGTTTCCCCAGATGGCATCAGG + Intergenic
1124956908 15:34366179-34366201 CAGTGTCAGAAAATGACCTCGGG - Intronic
1125423901 15:39531014-39531036 AAATCTCAGCAGAGAGCCTCAGG + Intergenic
1129842606 15:78753022-78753044 CAGGCACAGCAGGTGGCCTGGGG - Intergenic
1130418616 15:83718353-83718375 GAGTCTCATCAGAAGGACTCAGG + Intronic
1131313981 15:91316394-91316416 GAGTCTCAGAGAATGGCCTCAGG + Intergenic
1131512885 15:93059182-93059204 CAGTCTCAGCTGGTGTCCTGAGG - Intronic
1131825812 15:96322063-96322085 CAGTCTCTCCAGACAGCCTCGGG - Intergenic
1132625980 16:891706-891728 CAGTGTCTCCAGATGCCCTCAGG - Intronic
1133907064 16:10031979-10032001 CAGTTTCAGCCCATGTCCTCAGG + Intronic
1136268262 16:29133301-29133323 CAGTGCCAGGAGATGGCCTGGGG - Intergenic
1137897825 16:52233091-52233113 GGGTCTGAGCAGATGACCTCTGG + Intergenic
1140207389 16:72945102-72945124 CACTCTCAGCCGATGGCTTTAGG - Intronic
1140518259 16:75560220-75560242 CAGTGTCAGGAGATGGCGTGAGG + Intergenic
1141496838 16:84416256-84416278 TAATCTCAGCAGAGTGCCTCAGG - Intronic
1141946599 16:87315062-87315084 CATTCACAGCAGATGGCCCAGGG + Exonic
1142071574 16:88093639-88093661 CAGTGCCAGGAGATGGCCTGGGG - Intronic
1148484463 17:47981883-47981905 CAGTGACAGCTGATGGCCTGGGG - Intergenic
1149441076 17:56674464-56674486 CAGTCCCAGAAAATGGCCTGAGG + Intergenic
1151759028 17:76090288-76090310 CAGTGTCAGCGGCTGCCCTCGGG + Intronic
1151846503 17:76659617-76659639 CTGTCTGAGAAGAGGGCCTCAGG - Intergenic
1152880548 17:82812250-82812272 GTGTCTCAGAAGATGCCCTCGGG - Intronic
1153027321 18:683542-683564 CCGTCTCAGCAGCTGCTCTCTGG - Intronic
1154191799 18:12236356-12236378 CAGTCACAGCAGCTGGCACCTGG + Intergenic
1156474995 18:37399972-37399994 CAATCTCATCAGTTTGCCTCCGG - Intronic
1157090181 18:44627635-44627657 CAGTCTCAGGAGATGGGGCCTGG + Intergenic
1158305023 18:56095732-56095754 CAGTCTCAGCAGCTGAGTTCTGG - Intergenic
1160579947 18:79877971-79877993 CAGTCTCAGGACGTGGCCACAGG - Intronic
1160857092 19:1222510-1222532 CGGTCTCAGTGGGTGGCCTCGGG - Intronic
1161481648 19:4513691-4513713 CTTTCTCAGCAGATGGTGTCCGG - Exonic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1162498309 19:11035688-11035710 CGTTCTCAGCAGATGGCAGCTGG + Intronic
1162787253 19:13043509-13043531 CAGACTGCGCAGCTGGCCTCAGG - Intronic
1163730067 19:18943823-18943845 CAATATCAGCAGCTGTCCTCTGG + Intergenic
1164593266 19:29517729-29517751 CAGTGTCACCAGCTGGCCCCAGG + Intergenic
1167446176 19:49538963-49538985 CAGTCTCAACAGGTGGCATGTGG - Intronic
1167516268 19:49924791-49924813 CAGACTTAGCAGCTGGACTCAGG - Intronic
1168014271 19:53558700-53558722 CAGCCTCAGAAGCAGGCCTCGGG - Intronic
929821114 2:45274487-45274509 CAGCCTCAGCAGAGAGCCTCCGG - Intergenic
932071711 2:68627256-68627278 CAGTCTCAGCACATGTGTTCTGG - Intronic
933780185 2:85795789-85795811 CAGTCTCTCCAGATGGCTTTGGG - Intergenic
933792974 2:85897854-85897876 CAGTATTAGCAGGTGGCTTCAGG - Intergenic
933846977 2:86334716-86334738 CAGCCTGAGCAGATGGGCTCTGG - Intronic
935949286 2:108314329-108314351 CAGTCTCAGCTGATCTGCTCTGG - Intergenic
937370413 2:121293672-121293694 CAGTCTCTGCAGGGGGCCACGGG + Intergenic
937716375 2:125037772-125037794 CAGTTTCAGCCGATGGCCCCTGG - Intergenic
947361277 2:229347867-229347889 CAGACACAGCAGAGGGCCTAAGG - Intergenic
947946303 2:234105907-234105929 AAGCCTCAGCAGCTGGTCTCTGG + Intergenic
948352982 2:237355947-237355969 GAGTCTCCGCAGGCGGCCTCTGG - Intronic
1169080223 20:2793962-2793984 CACTCTCATCAGTTGGCTTCTGG - Intergenic
1171146579 20:22789433-22789455 CAGTTTTGGCAGGTGGCCTCTGG + Intergenic
1172026950 20:31955021-31955043 CAGTGTCTGCAGGTGACCTCTGG - Intergenic
1172356263 20:34282238-34282260 CATCCTCAGGAGATGGCATCTGG - Intronic
1172418012 20:34787807-34787829 CAGTCTCAGCACACTGCCTATGG - Intronic
1172950118 20:38717893-38717915 CAGCCTCACCAGATGTCCACGGG + Intergenic
1173002189 20:39112271-39112293 CAGTCTCTTCAGTGGGCCTCTGG + Intergenic
1173445039 20:43110109-43110131 CTGTATCAGGAGAAGGCCTCAGG + Intronic
1175192707 20:57222309-57222331 AAGGCCCACCAGATGGCCTCAGG + Intronic
1176012430 20:62906196-62906218 CAGGGTCTTCAGATGGCCTCAGG - Intronic
1181005435 22:20011218-20011240 CTGTCTCAGCTAATGGCCCCGGG + Intronic
1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG + Intronic
1182102438 22:27667589-27667611 CAGTCTCTGCAGAGGGACTGTGG + Intergenic
1183748833 22:39707617-39707639 CAGTCACTGCAGATGGGCCCAGG + Intergenic
1184474737 22:44714384-44714406 CTGTATCACCAGATGCCCTCTGG - Intronic
951624852 3:24648074-24648096 CAATCTCACCAGATTGCTTCGGG - Intergenic
951728020 3:25781911-25781933 AAGTCTCAGCTAATGGGCTCTGG + Intronic
953137031 3:40190140-40190162 GAGTCAGAGCACATGGCCTCAGG - Exonic
953848728 3:46449339-46449361 CAGTCCCAAGAGATGGCCTAGGG + Intronic
953906066 3:46868785-46868807 CACTCTCAGCAGCTAGTCTCAGG + Intronic
954834799 3:53456652-53456674 AACTCTCATCAGATGGCCTTTGG + Intergenic
956502643 3:69903407-69903429 CAGGCTCAGAAGAAGGTCTCAGG - Intronic
958878928 3:99647202-99647224 CAGTCCCAGGAGATGCGCTCAGG - Intronic
961156055 3:124680720-124680742 CATTGTCAGCCGATTGCCTCGGG - Intronic
961819953 3:129570976-129570998 CAGCCTCAGCTGTGGGCCTCGGG - Intronic
962317288 3:134366873-134366895 CAGTTTTAGCAGATGGCCTCAGG - Intronic
964872090 3:161324535-161324557 CAGACTCCCCAAATGGCCTCAGG - Intergenic
965665280 3:171087349-171087371 CATTCCCAGGAGATGGACTCTGG - Exonic
967043058 3:185711645-185711667 CTGGCTCAGCAGGTGGCCACAGG + Intronic
968974964 4:3817281-3817303 GGGGCTCAGCAGATGGCTTCTGG + Intergenic
976838423 4:89402768-89402790 CACTCTCAGCACATGGCTTTGGG + Intergenic
982167546 4:152628486-152628508 CAGCCTCAGCAGACTCCCTCAGG + Exonic
983260240 4:165448439-165448461 CTTTCTCAGCAGATGGGCTAGGG - Intronic
986885598 5:12230822-12230844 CAATCTCAGCAGATGCGCTGGGG - Intergenic
987112715 5:14702076-14702098 CAGTCCCAGCAGCTCGGCTCAGG - Intergenic
987524300 5:19028751-19028773 CTCTGTCATCAGATGGCCTCTGG + Intergenic
987594493 5:19979375-19979397 CAGTTTCAGCAGAAGGTCTGAGG - Intronic
988963560 5:36392939-36392961 CACTCACAGCAGAAGCCCTCTGG + Intergenic
991923456 5:71680688-71680710 CATGCACACCAGATGGCCTCTGG - Intergenic
991934272 5:71786331-71786353 CATTCCCAACACATGGCCTCGGG + Intergenic
995221594 5:109654623-109654645 CAGTGTCAGCAGCAGGCCCCGGG - Intergenic
997078470 5:130709703-130709725 CAGGCTCAGCAGATGCCTCCAGG - Intergenic
997166932 5:131671201-131671223 CAGGCTCAGCATATGTCCTTTGG + Intronic
997696801 5:135867475-135867497 GAGCCTCAGCAGATAGCCTCAGG - Intronic
998501253 5:142634947-142634969 AAGTCTCACCAGATGTCCCCAGG + Intronic
998952240 5:147404015-147404037 CAGCCTCAGCAGAGGGCATGAGG + Intronic
999670730 5:153957116-153957138 CAGCTTCACCAGATGGCCTGTGG + Intergenic
1001081746 5:168672321-168672343 TAGTCTCTGCAGGTGGACTCTGG + Intronic
1002213065 5:177609741-177609763 CAGGCTCAGGACAAGGCCTCAGG + Exonic
1003293546 6:4803675-4803697 CAGCATCAGCACGTGGCCTCGGG + Intronic
1003600672 6:7514301-7514323 CAGTCTCAGCACAAGGCATCTGG - Intergenic
1003895877 6:10607178-10607200 CAGTCTCGGCAGATCACCTGAGG - Intronic
1006918508 6:37612410-37612432 CAGTATCTGCAAATAGCCTCAGG - Intergenic
1007513336 6:42391527-42391549 CAGTCTCAGCAGATGGCCTCAGG + Intronic
1011023571 6:82841398-82841420 CAGTCCCAGCATTTGGTCTCTGG + Intergenic
1015158870 6:130128903-130128925 CAGGGTCAGCAGATGCTCTCTGG - Intronic
1017209423 6:151838367-151838389 CAGTCCCAGCAGATGGGCCTAGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019502169 7:1369742-1369764 CTGTCTCAGCCGATGGCCCTGGG + Intergenic
1020381641 7:7554066-7554088 TAGTCTCCCCAGTTGGCCTCTGG - Intergenic
1021656279 7:22877491-22877513 CGGAATCAGCAGATGTCCTCAGG - Intergenic
1022552717 7:31256662-31256684 CAGTCTCTGGAGCTGCCCTCAGG + Intergenic
1023588715 7:41758704-41758726 GAGTTTCAACACATGGCCTCTGG + Intergenic
1024207134 7:47173395-47173417 CAGTCTCAGAAGCTGGACACAGG - Intergenic
1024385095 7:48741893-48741915 CAGAATCAGCAGATGCCCTAGGG + Intergenic
1029359181 7:100075824-100075846 CTGCCTGAGCAGATGGCCACAGG + Intronic
1034430749 7:151040145-151040167 CAGTCTCTGCATTTGGCCACAGG + Intronic
1035398509 7:158550291-158550313 CAGCCTCAGGAGATGTCCTGAGG - Intronic
1035596163 8:859635-859657 CTGTCTCAGCACCAGGCCTCTGG + Intergenic
1035626728 8:1076510-1076532 TGGTCTCGGAAGATGGCCTCTGG + Intergenic
1040548581 8:48421157-48421179 CAGTCTCTGCAGAGGGGTTCTGG + Intergenic
1040605087 8:48923690-48923712 GAGTCCCAGCAGCTGGCCTTTGG - Intergenic
1040745262 8:50634356-50634378 AAGTCTCAGCAGAGGGCATCCGG - Intronic
1041364989 8:57092511-57092533 CAGGGTCAGCAGGTGGCCACTGG + Intergenic
1045727885 8:105196697-105196719 CAGTCTCAGCACATGCATTCTGG + Intronic
1045796187 8:106047708-106047730 CAGTCTCAGCTGCAGGCCCCTGG + Intergenic
1046656944 8:116905289-116905311 CAGCCTCAGCAGATGCCATAGGG + Intergenic
1047843493 8:128780062-128780084 AAGTCTCAGAAGAATGCCTCTGG + Intergenic
1048181964 8:132203406-132203428 CAGTCTCAGCAAACGACTTCTGG + Intronic
1048996874 8:139799954-139799976 CTGTCTCAGCTGCTGCCCTCTGG - Intronic
1049210034 8:141381747-141381769 CTGTCTCAACACAAGGCCTCAGG + Intergenic
1049361918 8:142216000-142216022 CTGCCTCAGCAGATGGCATGTGG + Intronic
1049465171 8:142747946-142747968 AGGTCGCAGCAGATGGCCTTGGG + Intergenic
1052569114 9:30198614-30198636 CATGCTGAGCGGATGGCCTCTGG + Intergenic
1053138000 9:35663807-35663829 CAGTTCCAGCTGAGGGCCTCAGG + Intronic
1058510489 9:105712732-105712754 CAGCCACACCAGATGGCCTGCGG - Intronic
1058952821 9:109919310-109919332 CCTTCTCAGCAGAAAGCCTCAGG + Intronic
1061495619 9:130972780-130972802 AAATCTCAGCAGATGGGCTGGGG + Intergenic
1061513986 9:131077908-131077930 CAGTGTCATCAGATGGACACGGG + Intronic
1062016252 9:134292734-134292756 CAGTCCCAGACGCTGGCCTCAGG - Intergenic
1185562939 X:1074545-1074567 CAGTCTCTGCAGATGACACCTGG - Intergenic
1190605795 X:52140229-52140251 CAGTGTCAGCAGATCCCCTGTGG + Intergenic
1190868673 X:54406564-54406586 CAGACTCATCTGATGCCCTCAGG - Intergenic
1191110811 X:56802205-56802227 CATTCTCAGGAGAAGGCCTTAGG - Intergenic
1192335923 X:70219759-70219781 GACTCTCAGAAGATGGGCTCAGG + Intergenic
1193188884 X:78545692-78545714 CAGTCTCATCAGATGCCTTAGGG - Intergenic
1196485515 X:116202863-116202885 AAGTCCCAGCTGATGGCCACAGG - Intergenic
1197726472 X:129780239-129780261 CAGACTCAACATATGGCCTTTGG - Intronic
1199818789 X:151424145-151424167 CAGGCTCTGCACATGGCATCAGG + Intergenic