ID: 1007513388

View in Genome Browser
Species Human (GRCh38)
Location 6:42391765-42391787
Sequence CAGAACATGGAGCAGTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 272}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007513382_1007513388 -2 Left 1007513382 6:42391744-42391766 CCTAGAACATCTGTGGGCCCTCA 0: 1
1: 1
2: 0
3: 12
4: 145
Right 1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG 0: 1
1: 0
2: 0
3: 26
4: 272
1007513381_1007513388 2 Left 1007513381 6:42391740-42391762 CCTGCCTAGAACATCTGTGGGCC 0: 1
1: 0
2: 0
3: 15
4: 93
Right 1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG 0: 1
1: 0
2: 0
3: 26
4: 272
1007513373_1007513388 26 Left 1007513373 6:42391716-42391738 CCCTCAGCCTTCCCGCCTACTCT 0: 1
1: 0
2: 1
3: 15
4: 250
Right 1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG 0: 1
1: 0
2: 0
3: 26
4: 272
1007513375_1007513388 19 Left 1007513375 6:42391723-42391745 CCTTCCCGCCTACTCTACCTGCC 0: 1
1: 0
2: 1
3: 27
4: 476
Right 1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG 0: 1
1: 0
2: 0
3: 26
4: 272
1007513378_1007513388 11 Left 1007513378 6:42391731-42391753 CCTACTCTACCTGCCTAGAACAT 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG 0: 1
1: 0
2: 0
3: 26
4: 272
1007513374_1007513388 25 Left 1007513374 6:42391717-42391739 CCTCAGCCTTCCCGCCTACTCTA 0: 1
1: 0
2: 0
3: 11
4: 233
Right 1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG 0: 1
1: 0
2: 0
3: 26
4: 272
1007513376_1007513388 15 Left 1007513376 6:42391727-42391749 CCCGCCTACTCTACCTGCCTAGA 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG 0: 1
1: 0
2: 0
3: 26
4: 272
1007513377_1007513388 14 Left 1007513377 6:42391728-42391750 CCGCCTACTCTACCTGCCTAGAA 0: 1
1: 0
2: 0
3: 10
4: 191
Right 1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG 0: 1
1: 0
2: 0
3: 26
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007513388 Original CRISPR CAGAACATGGAGCAGTGGGC TGG Intronic
900127071 1:1073420-1073442 CTGACCATGAGGCAGTGGGCTGG - Intronic
900412777 1:2520471-2520493 CAGCACATGGGGCGGGGGGCGGG - Intronic
901013443 1:6213741-6213763 CAGGACATGGAGGAGAGGGCAGG + Intronic
901973533 1:12926880-12926902 CAGAACATGGAGCACTGAATGGG - Intronic
901988893 1:13096550-13096572 CAGGACATGGAGCACTGAACGGG + Intergenic
901992920 1:13130217-13130239 CAGGACATGGAGCACTGAACGGG - Intergenic
902138243 1:14329566-14329588 CAGAACTGGGATCAGTGGGTGGG + Intergenic
902410611 1:16209745-16209767 CAGAGCAAGGACCTGTGGGCTGG - Intronic
902516128 1:16990479-16990501 GAGAACCTGGAGCCGTGGGCTGG + Intronic
903748091 1:25602177-25602199 AAGAACCTGGAGCAGAGGTCTGG + Intergenic
903884474 1:26532807-26532829 CAGAACTGGGGGCAGTGGTCTGG + Intronic
906104854 1:43285602-43285624 CAGAACCTGGACAGGTGGGCGGG + Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
907257227 1:53188948-53188970 CAGATATTGGAGCAGTTGGCAGG + Intergenic
908027543 1:59968655-59968677 CAGAGGATGGAGCTGTGGGAGGG + Intergenic
908398306 1:63746396-63746418 CAGAACAAGGTGGCGTGGGCTGG + Intergenic
909548003 1:76868486-76868508 CAGACCATGGCGCTGCGGGCGGG - Exonic
911254062 1:95614252-95614274 CAGTGCATGGAGCTGAGGGCCGG - Intergenic
912387448 1:109278892-109278914 TAGAAATTGGAGCAGGGGGCTGG + Intergenic
915006962 1:152647193-152647215 CAGTACATGGAACAGTGAGAAGG - Intergenic
915156968 1:153885051-153885073 CAGAAGATGGAGAACAGGGCCGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917653919 1:177106989-177107011 CAGGCCATGCAGCAGTGGGGTGG + Intronic
918263532 1:182818838-182818860 GAGCAACTGGAGCAGTGGGCAGG + Exonic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
920170071 1:204066398-204066420 CAAAGCATGGATCAGAGGGCCGG + Intergenic
920269343 1:204751637-204751659 CAGACGAGGGAGCAGTGGGAGGG - Intergenic
920601463 1:207329088-207329110 AAGAACATGGACCAGTGGGAGGG + Intronic
924263033 1:242251612-242251634 CTGAACATGGAGAAAAGGGCAGG + Intronic
1062825373 10:564304-564326 GAGGAGATGGAGCTGTGGGCTGG - Intronic
1064430713 10:15267790-15267812 CAGAACACGGAGCGGTGAGGAGG + Intronic
1065352905 10:24811556-24811578 CAGAACATGAAACACTTGGCAGG - Intergenic
1066306609 10:34150394-34150416 TAGAATATGGAGAAGAGGGCTGG + Intronic
1066721752 10:38346837-38346859 CCGAACATGGAGAAAAGGGCAGG - Intergenic
1069949762 10:72010778-72010800 CAGAGGAGGGAGCAGTGGGGAGG - Exonic
1069987252 10:72292819-72292841 CAGGAGATAGAGCAGTGAGCAGG - Intergenic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070599204 10:77853960-77853982 CAGAACATGCAGCAGGGCTCAGG - Intronic
1070720357 10:78752723-78752745 GAGAAGATGGAGCGGTGGGCTGG + Intergenic
1070796743 10:79221375-79221397 CAGAACAAAGAGCTGGGGGCTGG - Intronic
1070910127 10:80110536-80110558 CAGAACATCGAGCACTGGCCAGG - Intergenic
1071307043 10:84308806-84308828 CAGTACAGGGAGCAGAGGGCAGG - Intergenic
1073453891 10:103625123-103625145 CAGAACAAGTAGTAGTGGGTTGG - Intronic
1073920332 10:108451105-108451127 CAGAGAATGAAGCATTGGGCTGG - Intergenic
1074780128 10:116796551-116796573 CAGACCATGGAGCAGAGTGCAGG + Intergenic
1074808138 10:117074723-117074745 CAGGAAATGCAGCAGTAGGCAGG + Intronic
1076063306 10:127429809-127429831 CCGAACGTGGCGCTGTGGGCCGG - Intronic
1076882411 10:133245958-133245980 CAGCAAATGGAGCAATGAGCTGG - Intergenic
1078631230 11:13006577-13006599 GAGAAGCTGGAGAAGTGGGCTGG + Intergenic
1079398395 11:20085741-20085763 CAGAATGTTGAGCAGTGGACTGG - Intronic
1083413827 11:62512490-62512512 CAGTTTATGGAGTAGTGGGCAGG - Intronic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1084119955 11:67063093-67063115 CCAAACATGGGGCACTGGGCTGG + Intronic
1085515900 11:77111916-77111938 AAGAACCTGGAGCAGGGAGCAGG + Intronic
1086338968 11:85827559-85827581 TAGAATATGGAGGAGTTGGCAGG - Intergenic
1088572328 11:111234476-111234498 GAGAACATAGAGCAAGGGGCTGG + Intergenic
1088723966 11:112618359-112618381 GAGAAAATGGGGCAGTGGCCAGG - Intergenic
1088941951 11:114468313-114468335 CAGCATCTGAAGCAGTGGGCTGG + Intergenic
1089198743 11:116710775-116710797 ATGAACCTGGGGCAGTGGGCAGG - Intergenic
1089653756 11:119932452-119932474 CAGAAGATCGAGCAATTGGCTGG - Intergenic
1090280412 11:125451515-125451537 CAGAACAGGCTGCAGTGGGCGGG + Intronic
1090937838 11:131360979-131361001 CTGAACATTGAGAAGAGGGCAGG + Intergenic
1091306744 11:134541271-134541293 CAGACCGAGGAGCTGTGGGCTGG - Intergenic
1091769653 12:3142635-3142657 AAGAGCATGGCGCAGGGGGCAGG - Intronic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1093858680 12:24136609-24136631 CAGAACTTGTAGCAGTGAGGGGG + Intergenic
1093994984 12:25631258-25631280 CAGAAGAACCAGCAGTGGGCAGG - Intronic
1094654049 12:32403889-32403911 CATAAAAGGGAGCATTGGGCCGG - Intronic
1096615209 12:52828803-52828825 CAGAAGATGGAGGGGTGGGGAGG - Intronic
1096644052 12:53018862-53018884 CAGCCCGTGGAGCAGTGGGAAGG - Exonic
1098416452 12:70240622-70240644 GGGAAGATGGAGAAGTGGGCAGG + Intergenic
1100414131 12:94354506-94354528 CAGAACATGGAGCATTCCACAGG + Intronic
1101608986 12:106273063-106273085 CAGAACATTGATCAGTGGAGAGG - Intronic
1101980282 12:109399967-109399989 CAGAACAGTGGGCAGTGGGAAGG - Intronic
1103189007 12:118984450-118984472 CAGCACATGTAGCAGTCTGCAGG + Intronic
1103418781 12:120763160-120763182 CAGAACAGGGAGGAGATGGCTGG + Exonic
1103530296 12:121596439-121596461 CAGAACAGGGAACAAGGGGCCGG - Intergenic
1104809610 12:131612390-131612412 GATAACATGGAGCAGAGGGAAGG + Intergenic
1104894975 12:132159579-132159601 CAGGGCATGGAGATGTGGGCGGG + Intergenic
1105024345 12:132838463-132838485 CAGCACACGGAGGGGTGGGCAGG + Intronic
1106031477 13:26009448-26009470 CAGAACCTGGATGTGTGGGCTGG - Intronic
1106094335 13:26629442-26629464 CAGCAGGTGGAGCTGTGGGCAGG - Intronic
1106555854 13:30807881-30807903 CAGAAAATGGAACAGTGAGGAGG + Intergenic
1108707762 13:53005632-53005654 TAGAACATGGAGCACTGGACGGG + Intergenic
1114023247 14:18500334-18500356 CAGAACCTGCAGCAGTGTTCTGG - Intergenic
1114040848 14:18677024-18677046 CAGAACATCAAGCACTGGCCTGG - Intergenic
1114045886 14:18875528-18875550 CAGAACATCAAGCACTGGCCTGG - Intergenic
1114118328 14:19643942-19643964 CAGAACATCAAGCACTGGCCTGG + Intergenic
1114337166 14:21702185-21702207 CAGTACATGGAGCATTGTCCAGG + Intergenic
1115097485 14:29654771-29654793 CTGAACATGGAGCAATGGCCAGG + Intronic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1117997980 14:61496082-61496104 CAGCAGAGGGACCAGTGGGCTGG + Intronic
1119735241 14:76977446-76977468 CAGACCCTGGAGGAGTGGTCTGG - Intergenic
1120579057 14:86223587-86223609 GAGAACATGGACCAGTAGGCTGG + Intergenic
1121502683 14:94450837-94450859 GAGAGCATGGAACATTGGGCAGG - Intronic
1121999948 14:98639068-98639090 CAGCACATGGATGAGTAGGCAGG + Intergenic
1122058050 14:99118335-99118357 CACAATATGGTGCGGTGGGCCGG - Intergenic
1122722230 14:103728475-103728497 CACAGGATGGAGCTGTGGGCAGG - Intronic
1122819026 14:104331920-104331942 CTGAACATGCAGCCTTGGGCAGG - Intergenic
1123082525 14:105702460-105702482 CAGAACATGGCCCAGTGATCAGG + Intergenic
1127395546 15:58541536-58541558 CAAAACCTGGGGCAGTGGGTGGG + Intronic
1127398413 15:58562242-58562264 CATAACATTGAGCAGTTGGTGGG - Intronic
1127541282 15:59941369-59941391 CAGAAGAGGGAGCAGTGGGGTGG - Intergenic
1127774838 15:62256473-62256495 CAGGCCATGAAGCAGTAGGCAGG + Intergenic
1127775431 15:62260699-62260721 CAGGCCATGAAGCAGTAGGCAGG + Intergenic
1127828984 15:62733160-62733182 AAGAACATGGAGCTGTGGAGAGG + Intronic
1129283626 15:74506030-74506052 CAGGGCAGGGAGCAGTGGGACGG - Intergenic
1129296321 15:74602245-74602267 GAGAACCTGGGGCAGGGGGCAGG - Intronic
1129365061 15:75049068-75049090 GAGCACTTGGAGCAATGGGCAGG + Intronic
1129665526 15:77577475-77577497 CTGGGCATGGAGCAGTGAGCCGG + Intergenic
1132250635 15:100333173-100333195 TATAACATGGGGTAGTGGGCTGG - Intronic
1132944584 16:2525973-2525995 CAGAAAAAGGAACACTGGGCTGG - Intronic
1133194560 16:4159757-4159779 CAGAACATGGCGGAGCGGGTGGG + Intergenic
1133256120 16:4517437-4517459 AAGAAAAGGGAGCAGTGGCCAGG + Intronic
1133340308 16:5031688-5031710 GAGAACCAGGACCAGTGGGCTGG - Intronic
1136737605 16:32477640-32477662 AAGACCATGGGGCGGTGGGCAGG - Intergenic
1136777230 16:32878522-32878544 CAGAACCTGGAGAGGTGGGCAGG + Intergenic
1136893393 16:33982991-33983013 CAGAGCCTGGAGAGGTGGGCAGG - Intergenic
1137337707 16:47566659-47566681 CAGCCCCTGGAGCAGTGGGAAGG + Intronic
1137687439 16:50396239-50396261 CAAAAAAGGAAGCAGTGGGCAGG + Intergenic
1137898393 16:52238278-52238300 GAGGCCATGGAGCAGTGGGATGG + Intergenic
1138208415 16:55142472-55142494 CAAAACAGAGAGCAGTGTGCAGG - Intergenic
1138294495 16:55874730-55874752 CAGAACGTGGAGCCTTGGGAAGG + Intronic
1139470492 16:67175473-67175495 CTGAACATGGAGCAAGGGGAGGG + Exonic
1203015466 16_KI270728v1_random:351937-351959 AAGACCATGGGGCGGTGGGCAGG + Intergenic
1203033801 16_KI270728v1_random:625095-625117 AAGACCATGGGGCGGTGGGCAGG + Intergenic
1203079644 16_KI270728v1_random:1140631-1140653 CAGAGCCTGGAGAGGTGGGCAGG + Intergenic
1142802161 17:2353071-2353093 TAGAATATGCAGCAGTGGGCCGG - Intronic
1142886102 17:2912879-2912901 AAGAACATGGAGATGTTGGCTGG + Intronic
1144415453 17:15042279-15042301 CAGGACATGGAGCAGGGAGAAGG - Intergenic
1145230991 17:21173028-21173050 CAGAAGATGTAGCAGCGGGTGGG - Intronic
1146992566 17:37288461-37288483 CAGAACACGAATCAGTGGGCTGG + Intronic
1147170836 17:38617807-38617829 AAGAACATGTAGCTATGGGCAGG + Intergenic
1148666474 17:49378738-49378760 CAGAACACTGAGCACAGGGCTGG - Intronic
1149656551 17:58312263-58312285 GAGAACCTGGACCTGTGGGCCGG - Exonic
1149994786 17:61400667-61400689 CAGAACCTGGAGCCGGGAGCCGG - Intronic
1152926289 17:83089225-83089247 AAGAACAGGGAGCAGTGGGTAGG - Intronic
1154521880 18:15238853-15238875 CAGAACCTGTAGCAGTGATCTGG - Intergenic
1155234253 18:23803682-23803704 GAGAACTTTGAGCAGTGTGCTGG - Intronic
1155354426 18:24937628-24937650 CATAACATGGAGCAGCAGGTCGG - Intergenic
1155910286 18:31498028-31498050 GAGAAAATGGAGCCGGGGGCCGG - Exonic
1156290664 18:35746884-35746906 CAGACCACGGTGCAGTGAGCAGG - Intergenic
1157568646 18:48697660-48697682 CAGCAGAAGGAGCACTGGGCTGG - Intronic
1157733677 18:50027359-50027381 CTGAACATGGAGCCCTGTGCAGG - Intronic
1160125639 18:76169234-76169256 GAGAACCTGCAGCAGTGGACTGG + Intergenic
1162015058 19:7841157-7841179 CAGAACATGGAATGGTGGGTGGG + Intronic
1162263035 19:9547890-9547912 CTGCACTTGGAGCAGTCGGCTGG + Intergenic
1162576295 19:11500949-11500971 CAGAAGTTGGAGAAGTGGACAGG - Intronic
1162938115 19:13991956-13991978 CAAAACATGTAGCAATTGGCCGG - Intronic
1164183168 19:22837585-22837607 CAGAACAATGAGCAGTGTGACGG - Intergenic
1164663946 19:30010044-30010066 CAGTACATGGAGCAGAGAGAGGG - Intronic
1165942283 19:39420938-39420960 CAGGAGATGGAGCTGTGGGAGGG - Exonic
1166230659 19:41424411-41424433 GGGGACATGGGGCAGTGGGCAGG - Intronic
1168144132 19:54410077-54410099 CAGAACATGCAGCAGTGCCTGGG + Intergenic
925412498 2:3648015-3648037 CTGATGATGGTGCAGTGGGCAGG + Intergenic
926044959 2:9703592-9703614 CAAAATAGGGAGCAGTGGGGTGG - Intergenic
927208075 2:20622585-20622607 CAGAACGTGGTACAGTGGGGTGG - Intronic
928776564 2:34771612-34771634 AGGAAGCTGGAGCAGTGGGCAGG - Intergenic
929465156 2:42137522-42137544 GAGGAGAGGGAGCAGTGGGCAGG - Intergenic
930381957 2:50641370-50641392 GAGAAAATGGAAGAGTGGGCAGG + Intronic
930398682 2:50855109-50855131 AAGAACGTGGTGCAGTGGGGTGG + Intronic
932322585 2:70833144-70833166 CAGCAAATGGAGCTGTGCGCTGG + Intronic
932337876 2:70941351-70941373 CAGAAAGAGGGGCAGTGGGCTGG - Exonic
932710125 2:74056921-74056943 CACAACTTGGAGAAATGGGCTGG + Intronic
933873390 2:86593053-86593075 CAGAAAAGCGAGCAGTGAGCTGG - Intronic
936713444 2:115160527-115160549 GAGAATATGGGGCAGTGGGGTGG - Intronic
938015064 2:127859989-127860011 CAGCACATGGTGCAGTGGCTGGG - Intergenic
938269344 2:129955563-129955585 CAGAACATCAAGCACTGGCCCGG + Intergenic
938521245 2:132072583-132072605 CAGAACCTGTAGCAGTGATCTGG - Intergenic
940165529 2:150766299-150766321 TAGCACATGGAACAGTGGGAAGG - Intergenic
941047097 2:160688933-160688955 CAGCACAAGGATCAGGGGGCTGG - Intergenic
941846572 2:170140314-170140336 CTGAACATGGAGCAGGGGCTGGG - Intergenic
943025947 2:182628818-182628840 GAGAACATGGATCACTGGGGGGG - Intergenic
944437654 2:199707206-199707228 CAGAAAATTGAGGAGTGGGGAGG - Intergenic
944605209 2:201346426-201346448 CAGAGCAGGGACCAGTGGCCTGG + Intronic
947327520 2:228994080-228994102 CAGAACATGTGCCAGTGGCCTGG + Intronic
947542771 2:230990318-230990340 CCGGACATGGAGCAGCGGCCTGG + Intergenic
948216993 2:236239455-236239477 CAGAACTGGGACCAGAGGGCGGG - Intronic
948217009 2:236239534-236239556 CAGAACTGGGACCAGAGGGCGGG - Intronic
1168852179 20:984578-984600 AGGAGCATGGAGCATTGGGCTGG - Intronic
1168930539 20:1619815-1619837 CAGGCCATGGCTCAGTGGGCAGG + Intronic
1172953943 20:38742082-38742104 AAGTAGATGGAGCAGGGGGCAGG - Intergenic
1173107552 20:40152024-40152046 CAGGACATGGAGCAGGGGCTGGG - Intergenic
1173189956 20:40868648-40868670 CAGAAAATGCACCAGTGTGCGGG + Intergenic
1175201981 20:57284281-57284303 GAGAACATGGAGCAGTGTCTAGG + Intergenic
1175453544 20:59091792-59091814 CAGAACATGGAACTTTGGGGTGG - Intergenic
1175972072 20:62691778-62691800 CAGAAAATGAAACCGTGGGCTGG + Intergenic
1177182407 21:17757864-17757886 CTGCACTTGGAGCAGCGGGCTGG - Intergenic
1178724122 21:35036074-35036096 CAGAAGAGGGAGCAGGGAGCAGG + Intronic
1180447350 22:15427290-15427312 CAGAACCTGCAGCAGTGTTCTGG - Intergenic
1180464417 22:15598145-15598167 CAGAACATCAAGCACTGGCCTGG - Intergenic
1180702775 22:17790706-17790728 CAGAAAATGGAGCGTTGGGTGGG + Exonic
1185220996 22:49629263-49629285 CAGAACAAACAGCACTGGGCTGG + Intronic
949255943 3:2046218-2046240 CAGCACATGGAGCTGAGGCCAGG - Intergenic
949847229 3:8384045-8384067 CACAGCATGGAGCACTGGGAAGG - Intergenic
951826275 3:26872829-26872851 CAGAAAATGTAGCAGTGGCAGGG - Intergenic
953810108 3:46104863-46104885 CAGAACAAGAAGCAGTGGGTTGG - Intergenic
954136534 3:48584561-48584583 AAGGACAGAGAGCAGTGGGCAGG + Intronic
958538404 3:95434087-95434109 CAGAAAATGTAGCAGTGGAAGGG - Intergenic
960912189 3:122660823-122660845 CAGCCCGTGGAGCAGTGGGAAGG - Intergenic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
962275158 3:134007630-134007652 CTGACCCTGGAGTAGTGGGCAGG + Intronic
962310623 3:134324437-134324459 CAGAGCCTGGAGCAGTGGCATGG + Intergenic
962420488 3:135224924-135224946 TAGAACAGGGAGCAGCGGCCTGG - Intronic
966254641 3:177904001-177904023 AAGAAATTGGAGTAGTGGGCAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967412181 3:189178057-189178079 CTGAGCATGCAGCAGTGTGCTGG + Intronic
967754129 3:193149478-193149500 AAGAACCTGGAGCTCTGGGCAGG - Intergenic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
968940840 4:3636805-3636827 ATCAACATGGAGCAGGGGGCAGG - Intergenic
969746946 4:9080056-9080078 CAGAACATGGGCCAGGGGCCAGG - Intergenic
969874943 4:10129345-10129367 AAGAACATGAGTCAGTGGGCTGG - Intergenic
973645668 4:52949086-52949108 GAGAACATGGAGCACTGGTGAGG - Intronic
976163125 4:82225054-82225076 CAGATGAAGGAGCAGTGGTCTGG - Intergenic
977833210 4:101617695-101617717 CAGAACTTTGAGCAGTGCACTGG - Intronic
979603349 4:122609743-122609765 CTGAACATGGAGGAGTGGCCAGG + Intergenic
982573046 4:157074961-157074983 CAGGACCTGGTGCAGTGGGGTGG + Intergenic
985803663 5:2022547-2022569 CAGAACTTGCAGCAATGGGGAGG + Intergenic
985989324 5:3542525-3542547 CTGAGCATGCAGCCGTGGGCAGG - Intergenic
986371879 5:7088143-7088165 CAGCACCTGGAGCAGATGGCTGG + Intergenic
986883761 5:12208519-12208541 CAGAACATGGAGCACTAAGTGGG - Intergenic
988778998 5:34502345-34502367 CAGAAAATGGTGCCGTGTGCTGG + Intergenic
992085038 5:73270602-73270624 CAGGACATGAGGCATTGGGCTGG - Intergenic
993163054 5:84314279-84314301 CAGATCATGGAGAAGAGGGTAGG + Intronic
993495666 5:88605898-88605920 CAGAAAAGGGAGTACTGGGCAGG - Intergenic
994162173 5:96568945-96568967 CAGAAAATAGAAGAGTGGGCTGG + Intronic
995411634 5:111864151-111864173 CAAAACATGGTGCAGTGAGTAGG - Intronic
997611906 5:135221281-135221303 GAGATCATGGAGCACTGAGCTGG + Intronic
997676534 5:135717228-135717250 CAGAAAGAGGACCAGTGGGCAGG - Intergenic
997859179 5:137400964-137400986 CAGCACATGAAGGGGTGGGCGGG - Intronic
998671299 5:144357264-144357286 CTGCACATGGAGCAATAGGCTGG - Intronic
999147853 5:149407606-149407628 CTGCACATGGAGCAATGGGAAGG + Intergenic
1004255332 6:14058196-14058218 CAGAACATGGATCATTGTGAGGG - Intergenic
1006344719 6:33471551-33471573 CAGAAAATGACGCAGAGGGCAGG + Intergenic
1006922067 6:37633679-37633701 CAGAATTTGGAGCCGAGGGCAGG + Exonic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1007583939 6:42977493-42977515 CAGAATATGGATCAATAGGCCGG + Intronic
1012555611 6:100507386-100507408 CAGAACATGCACCTCTGGGCTGG - Intergenic
1013367709 6:109447827-109447849 CTGAGCAGGGAGGAGTGGGCAGG - Intronic
1013959077 6:115876216-115876238 CCAAACAAGGAGCAATGGGCTGG + Intergenic
1014210589 6:118704341-118704363 CAGAAAATGAGCCAGTGGGCAGG - Intronic
1015506644 6:133995280-133995302 CAGATGATGCAGCAGTGAGCTGG + Intronic
1017229681 6:152060315-152060337 AAGAACATAGAGCAGTGTGTTGG - Intronic
1017409853 6:154156527-154156549 CAGAGCATGGGGCAGCGGGAGGG + Intronic
1022381733 7:29866760-29866782 CAGAGCAGGAAGGAGTGGGCAGG - Intronic
1022589088 7:31643774-31643796 CAGCAGATGCAGCAGTGGGCAGG - Exonic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023337653 7:39186935-39186957 CAGAACACAGAGCAGGCGGCAGG - Intronic
1029658610 7:101944187-101944209 CAGAAAGGGGCGCAGTGGGCTGG + Intronic
1029895545 7:103979603-103979625 CAGAACTTTGAGCAGTGAACAGG + Intronic
1029958764 7:104667964-104667986 CAGCCCGTGGAGCAGTGGGAAGG - Intronic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1032389164 7:131544573-131544595 CAGATCAGGGAGGCGTGGGCAGG + Intronic
1033497601 7:141915552-141915574 TAGAAAATGGAGCAGTAGGAAGG - Intronic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1034931701 7:155168337-155168359 CAGAACATGCAGCAGCAGGAGGG - Intergenic
1036123834 8:6045294-6045316 CAGCACTTGGAGCAGCCGGCTGG - Intergenic
1036661198 8:10710287-10710309 TAGAACATTGATCAGTGTGCAGG - Intronic
1037970975 8:23171667-23171689 CAGAACATGGACCAGGGTGGGGG + Intergenic
1040608656 8:48960495-48960517 CAGAAAATGTAGCCATGGGCAGG - Intergenic
1042844804 8:73159086-73159108 CCCCACATGGAGGAGTGGGCTGG + Intergenic
1043526611 8:81104601-81104623 CAGAGGATGGAGCAGTTTGCAGG - Intronic
1044803214 8:95978258-95978280 CAGAAAGTGAAGCCGTGGGCAGG - Intergenic
1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG + Intronic
1047404955 8:124577741-124577763 AAGAACAAGGAGCAGAGGGTGGG - Intronic
1047643283 8:126843742-126843764 CAGACCAGGGAGCAAGGGGCTGG - Intergenic
1049085454 8:140474889-140474911 CATAAGATGGAGGAGGGGGCTGG + Intergenic
1049280663 8:141742518-141742540 CAGAGCTGGGTGCAGTGGGCTGG + Intergenic
1049447881 8:142639852-142639874 CATTAAATGGTGCAGTGGGCTGG - Intergenic
1051674713 9:19547346-19547368 CTGCACAGGGAGCAGTGGACTGG + Intronic
1052997163 9:34557249-34557271 CAGAACATGCAGCAGGGGGAAGG - Intronic
1054877016 9:70107513-70107535 CAAAACATGTAGCACAGGGCTGG - Intronic
1055552951 9:77447754-77447776 GAGAGCATGGAGCAGTGTTCAGG + Intronic
1056275036 9:84986201-84986223 CTGAATATGGAGCAGGGGTCGGG - Intronic
1057392658 9:94652596-94652618 CTGAATATGGAGCGGGGGGCGGG - Intergenic
1057563330 9:96146222-96146244 CAGCCCGTGGAGCAGTGGGAAGG - Intergenic
1059658967 9:116382526-116382548 CACAAGCTGGAGAAGTGGGCAGG - Intronic
1060228151 9:121808730-121808752 GAGGACATGGAGGGGTGGGCTGG - Intergenic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061840572 9:133356530-133356552 CAGAACCTGGAGCCGGGGGCGGG - Exonic
1062681183 9:137782135-137782157 CAGAGGATGGTGCTGTGGGCGGG + Intronic
1185543198 X:920555-920577 CAGAACATGAGGCAGGGAGCCGG - Intergenic
1189320265 X:40083414-40083436 CAAAACTTGGAGGTGTGGGCGGG - Intronic
1189636157 X:43011988-43012010 CAGAACATGGATCACAGGGAAGG - Intergenic
1189914487 X:45843346-45843368 AAGAACATGGGGCAGTGGGAGGG + Intergenic
1191904696 X:66076113-66076135 CAGCCCGTGGAGCAGTGGGAAGG + Intergenic
1191921227 X:66259095-66259117 TAGTACATGGAGCACTGAGCTGG + Intronic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1193044010 X:77033250-77033272 CAGAAGCTGGACCACTGGGCTGG - Intergenic
1193277371 X:79604913-79604935 CAGAAGAAGGAGCGTTGGGCTGG - Intergenic
1193406629 X:81108752-81108774 CAGAAGACGGACCACTGGGCTGG + Intergenic
1194746120 X:97630243-97630265 CAAACCATGGACCAATGGGCCGG + Intergenic
1195285887 X:103383303-103383325 CAGAACTGGGAGAAGTGGGTGGG - Intergenic
1196080068 X:111621253-111621275 CAGCCCGTGGAGCAGTGGGAAGG + Intergenic
1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG + Intergenic
1198666764 X:139032736-139032758 CAGAGCAGGAAGCAGTGAGCTGG - Intronic
1200084470 X:153596831-153596853 CAGCACATTGAAAAGTGGGCTGG + Intronic
1200102630 X:153695526-153695548 CAGAGCCTGGAGAGGTGGGCAGG - Exonic
1200213474 X:154357100-154357122 CAGAAGATGAGGCCGTGGGCTGG - Intronic