ID: 1007517558

View in Genome Browser
Species Human (GRCh38)
Location 6:42425417-42425439
Sequence CCCTTTATGTGCTCTGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007517558_1007517562 14 Left 1007517558 6:42425417-42425439 CCAGTCACAGAGCACATAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1007517562 6:42425454-42425476 GAGTCAAATCAAGTCCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007517558 Original CRISPR CCCTTTATGTGCTCTGTGAC TGG (reversed) Intronic
902136014 1:14306263-14306285 CCCCTGATGTGCTCTCTGAAAGG + Intergenic
903397335 1:23011821-23011843 GGCTTTATGTCCACTGTGACTGG - Intronic
904341221 1:29836189-29836211 CCCATTAGGTGCTCTGAGATTGG - Intergenic
904376177 1:30083891-30083913 CCCTGTCTGTGCTGTGTGGCTGG - Intergenic
906726389 1:48047597-48047619 TCCTTGCTGTGCTCTGTGTCTGG - Intergenic
907323646 1:53621217-53621239 CCCTTTATGGACTGTGTGCCAGG - Intronic
909055137 1:70811848-70811870 CCCTTAATATGCTCTGGGATAGG + Intergenic
909529753 1:76669239-76669261 CCCTATGTGTGTTCTGTAACAGG + Intergenic
911353898 1:96792256-96792278 CCATTTTTGTGTTCTGTGTCAGG + Intronic
916476160 1:165170981-165171003 CCGTTTAGGAGCTCTGAGACAGG - Intergenic
917231057 1:172838619-172838641 CCCTTCATTTCCTCTGTTACTGG - Intergenic
918438790 1:184544977-184544999 CCCCTTGGGTGCTCTCTGACTGG - Intronic
918531566 1:185527913-185527935 CCTTTCATGTGCTCTGTAACAGG + Intergenic
920348755 1:205323593-205323615 CTCTTTATCTCCTTTGTGACTGG + Intergenic
924296066 1:242587480-242587502 TCCTCTATGTGCTCTGTCCCAGG - Intergenic
924951606 1:248889748-248889770 CCCTTCAGGTGCTCTAAGACAGG + Intergenic
1071394969 10:85213739-85213761 CCCTCTAAGTGCTCTGAGAATGG - Intergenic
1074634651 10:115300990-115301012 CAGTATATGTGCTTTGTGACTGG + Intronic
1080613424 11:33925218-33925240 CTCTTCAGTTGCTCTGTGACAGG + Intergenic
1086416130 11:86590567-86590589 GCCTTGAGGTGCTCTGTGGCTGG - Intronic
1089390859 11:118100743-118100765 CCCTTTATCTCCACTGTGGCAGG - Intronic
1091453252 12:586778-586800 GCCTTTCTGTGCCCTCTGACTGG + Intronic
1092587937 12:9919808-9919830 CCCTCTGTGAGCTCTGTGCCAGG + Intronic
1093401605 12:18753258-18753280 CCCTTTTTGTGTTCTGGGAAAGG + Intergenic
1094330510 12:29287003-29287025 CCATTGATTTGCTATGTGACTGG - Intronic
1096694647 12:53340724-53340746 CCCTCTATGTTCTCTGTCGCTGG - Intronic
1097079881 12:56422164-56422186 CCATGTAGGTGCTCTGCGACTGG + Exonic
1098278582 12:68839215-68839237 CCCTTTAACTGCTCAGTCACAGG - Intronic
1102903441 12:116656729-116656751 CCCTTTCTGGGCTCTGCAACAGG - Intergenic
1103179030 12:118891652-118891674 CACTTTCTGTGCTCTTTGCCTGG - Intergenic
1105617950 13:22037796-22037818 CCCTATATGTGCATTATGACAGG + Intergenic
1105819169 13:24064173-24064195 CGCATTAAGTGATCTGTGACAGG - Intronic
1108249723 13:48551974-48551996 ACCTCTAATTGCTCTGTGACTGG + Intergenic
1108441534 13:50458008-50458030 CTATTAATGTGCCCTGTGACTGG + Intronic
1112928281 13:104704276-104704298 CACTTTTTTGGCTCTGTGACAGG + Intergenic
1114036059 14:18628662-18628684 CCATTTATTTGCTATGTGCCTGG - Intergenic
1114122579 14:19686368-19686390 CCATTTATTTGCTATGTGCCTGG + Intergenic
1117146848 14:52844456-52844478 CCCTTTATGTGCTATTTGTCAGG - Intergenic
1117770486 14:59129414-59129436 CCCAGTATGTGCTGTCTGACTGG + Intergenic
1118015742 14:61658794-61658816 CACTTTATGTGTTTTGTCACAGG - Intergenic
1119328223 14:73774887-73774909 CACAGTAGGTGCTCTGTGACAGG - Intronic
1119343854 14:73905002-73905024 CCCTTTATGTGCCATGAGTCTGG + Exonic
1119954562 14:78782778-78782800 CCACTTATTAGCTCTGTGACTGG - Intronic
1121975063 14:98395815-98395837 CTCTTTATTAGCTCTGTGATTGG - Intergenic
1121975373 14:98398631-98398653 CTCTTTATTAGCTCTGTGATTGG - Intergenic
1122429697 14:101632528-101632550 CCCAGGATGTGCTGTGTGACAGG + Intergenic
1122480168 14:102042031-102042053 GTCTTAATGTGCTCTGTGCCTGG + Exonic
1125483866 15:40098949-40098971 CCCTGTGTTTGCTCTGTGGCTGG - Intronic
1125753759 15:42048566-42048588 CCTCATATGTGCACTGTGACAGG + Intronic
1126654061 15:50956857-50956879 CCCTTTGTGGGCTTTGAGACGGG + Intronic
1126812739 15:52424490-52424512 AACATTATGTGCTCTGTGAAGGG - Intronic
1127796633 15:62443980-62444002 CCCTTTATTTGTTTTGAGACAGG - Intronic
1130977964 15:88791834-88791856 CTCTTTGTGTGCCCTGTGTCTGG - Intergenic
1131957038 15:97747964-97747986 CCCTGAATGTGCTCCCTGACTGG - Intergenic
1133016836 16:2947213-2947235 CACTCTGTGTGCTTTGTGACTGG - Intronic
1133300509 16:4779592-4779614 ACCTTTCTGTGCCCTGTGATGGG + Intronic
1134059577 16:11191089-11191111 GCCTGTATCTGCTCTGTGAGAGG - Intergenic
1139375602 16:66494602-66494624 CTCTTTATTTGCACTGTGATAGG - Intronic
1140722183 16:77781908-77781930 ACATTTATGTGCTGGGTGACAGG - Intergenic
1141291665 16:82723426-82723448 TCCCTTAAGTTCTCTGTGACTGG + Intronic
1143937629 17:10503649-10503671 CCCTTTGTCTACTCTGTCACTGG - Intronic
1144936470 17:18903020-18903042 GCCCTCATGTGCTCTTTGACTGG + Intronic
1146784754 17:35709600-35709622 CTATTTATTTGCTGTGTGACTGG + Intronic
1148053481 17:44780340-44780362 CCCTGACTGTGCTCAGTGACAGG - Exonic
1150774267 17:68066517-68066539 CCATTTATTGGCTATGTGACTGG + Intergenic
1152552631 17:81037429-81037451 ACCTTTTTGTGCTTTGTCACTGG + Intronic
1153577166 18:6533977-6533999 TCTTGTATTTGCTCTGTGACAGG + Intronic
1154279764 18:12991838-12991860 TCCTTTATGTGCCCTGTGATGGG + Intronic
1155038197 18:22042925-22042947 CCCTTTCTGAGGTCTGTGCCAGG + Intergenic
1156590524 18:38482834-38482856 GCCTTTATGTCCTCTGTAATGGG - Intergenic
1160154401 18:76422632-76422654 CCATTTATTTGCTCTGTGCTAGG - Intronic
1164805762 19:31115374-31115396 CCCCTAATCTGCTGTGTGACTGG - Intergenic
1165090845 19:33387744-33387766 CCCTTCGTGTGGTCTGTCACAGG - Intronic
1166593057 19:44018332-44018354 CCTTTTATGTACTCAGTCACAGG - Intergenic
926226075 2:10967755-10967777 TCCTTCATCTGCTGTGTGACGGG + Intergenic
927967035 2:27276960-27276982 CTCTGTCTCTGCTCTGTGACAGG - Intronic
928598180 2:32877239-32877261 CGGTTTCTGTGCTCTGTGATGGG + Intergenic
930180364 2:48349829-48349851 CCATTTCTGTGCTCTGTCAAAGG - Intronic
934132030 2:88957403-88957425 CGCCTTCTGTGCTCTGAGACTGG - Intergenic
938274333 2:130004285-130004307 CCATTTATTTGCTATGTGACTGG + Intergenic
938441051 2:131332974-131332996 CCATTTATTTGCTATGTGACTGG - Intronic
938971971 2:136441071-136441093 CCCTTCATCTGCTCTGCCACTGG + Intergenic
939752796 2:146068341-146068363 CCATTTATGTGCTATGTCTCAGG - Intergenic
940005185 2:149003503-149003525 CCCTTGCTGTCCACTGTGACAGG + Intronic
942989434 2:182181683-182181705 CCCTTCAGGTGCTCTGTCCCAGG + Intronic
944399766 2:199311948-199311970 CCCTTTATCTCTTCTGTGATGGG - Intronic
945487181 2:210410225-210410247 CCCTGCCTGTGCTCTGTGAATGG - Intergenic
1169271950 20:4207417-4207439 CGTTTTAGGAGCTCTGTGACAGG - Intergenic
1170252327 20:14297997-14298019 CCCTTCCTGTGCTCTGTAAATGG + Intronic
1170809727 20:19664531-19664553 TGCTTTATGCGCTTTGTGACTGG + Intronic
1171337870 20:24402497-24402519 CCCTTTGTGGGAACTGTGACAGG + Intergenic
1172174049 20:32961565-32961587 ACCTTCATGTCCTCTGTGAAGGG + Intergenic
1174163198 20:48566157-48566179 CACTTGCTGTGCTCTGTGCCTGG - Intergenic
1174721129 20:52813620-52813642 CACTATGTGTGCTCTGTGAGTGG - Intergenic
1175858980 20:62139495-62139517 CCCTTCAACTGCTTTGTGACTGG + Intronic
1179602316 21:42488140-42488162 CCCATGATGTGATGTGTGACAGG + Intronic
1180013920 21:45070565-45070587 GTCTGTCTGTGCTCTGTGACAGG - Intergenic
1180019267 21:45110921-45110943 CCCATTCTCTGCTCTGTGAGGGG + Intronic
1180460185 22:15555724-15555746 CCATTTATTTGCTATGTGCCTGG - Intergenic
1183411351 22:37656600-37656622 CCCTAAATCTGCTCTGTGCCAGG + Intronic
949593646 3:5520346-5520368 CCCTCTTTGTGCTCTGTGTGGGG + Intergenic
950080562 3:10219241-10219263 CCCTTCATGTCCTCTGTCACAGG - Intronic
951896712 3:27616430-27616452 CCCTTTACTAGCTATGTGACTGG + Intergenic
952515577 3:34101514-34101536 CTCTTTCTGTGCTCTATGAATGG - Intergenic
953203276 3:40797248-40797270 TCCATTATGTGCCCTGTAACTGG - Intergenic
956207680 3:66771432-66771454 TCCTGTAGGTGCTCTGTGCCAGG + Intergenic
960600995 3:119458282-119458304 CCCTTTATGTTCTGTGATACTGG - Intronic
962850357 3:139303833-139303855 CCATTTCCATGCTCTGTGACTGG + Intronic
964391210 3:156200431-156200453 TCCTTTAGGTGCTCTGTCCCAGG + Intronic
964720975 3:159766710-159766732 CCATGTATGTGCTGTGTGCCAGG + Intronic
969233780 4:5851006-5851028 CCATTTATGAGCTCTGACACAGG - Intronic
970202177 4:13621095-13621117 CCCTTGATGTGCTCCCTGAGGGG + Intronic
972285297 4:37642561-37642583 GCCTTTAGGAACTCTGTGACAGG - Intronic
978148201 4:105402618-105402640 CCCTTAGAGTCCTCTGTGACTGG - Intronic
981429424 4:144643339-144643361 CACTTTATGTGCTCTTGCACAGG + Intergenic
983131333 4:164023091-164023113 CCCTCTCTGTGCTCTGAGAGCGG - Intronic
986267412 5:6202416-6202438 CCCTTTATGTGAGGTGAGACAGG + Intergenic
989194209 5:38700167-38700189 TCCTTTAGGTGCTCTGTCCCAGG - Intergenic
993145213 5:84085803-84085825 CCCTCCATGTGCTCTGTCCCAGG + Intronic
994852402 5:105072457-105072479 GCCTTAATGTGCTCTGTGGGAGG - Intergenic
1000848076 5:166305841-166305863 CGTTTTAGGAGCTCTGTGACAGG + Intergenic
1001155330 5:169267911-169267933 TAGTGTATGTGCTCTGTGACTGG - Intronic
1002036874 5:176477760-176477782 TCCTTTATGTGCAATGTGAAGGG - Intronic
1003050097 6:2772451-2772473 CACATTATGTGCTTTGTGAATGG + Intronic
1003117098 6:3290146-3290168 CCGTTTGTGTGCACTCTGACTGG - Intronic
1003646261 6:7915155-7915177 CCCTTCCTGTCTTCTGTGACTGG + Intronic
1005092323 6:22070606-22070628 GTCTTTATGTGCTCTGGTACAGG + Intergenic
1007517558 6:42425417-42425439 CCCTTTATGTGCTCTGTGACTGG - Intronic
1013889130 6:115005084-115005106 CCCTTTATCTGCCCTGGGAAGGG + Intergenic
1015002113 6:128230454-128230476 CCGTCCATGTGCTCTGTGCCAGG - Intronic
1020359871 7:7316391-7316413 CCCTTTTTCTGCCCTGTGACTGG - Intergenic
1020570001 7:9847351-9847373 ACCTACATGTGCTCTGAGACAGG - Intergenic
1021508367 7:21409710-21409732 GGCTTTAGGAGCTCTGTGACAGG + Intergenic
1021869357 7:24988416-24988438 TCTTTTATGTGCTATGTGAAAGG - Intergenic
1021869529 7:24990629-24990651 TCTTTTATGTGCTATGTGAATGG - Intergenic
1022951287 7:35340520-35340542 CCCTTGATGTGCAGTGTGGCAGG - Intergenic
1028135739 7:87220903-87220925 GCCTTGATTTGTTCTGTGACAGG + Intergenic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1033632501 7:143172730-143172752 CTCTTTATATGTTCTATGACAGG - Intergenic
1033883600 7:145917201-145917223 CCCTTCATGGGTTTTGTGACAGG - Intergenic
1038320199 8:26518697-26518719 CCGTTTATGTTCTTTGCGACTGG + Intronic
1038417734 8:27409506-27409528 CCCACAATGTGCTCTGTGCCTGG - Intronic
1038538610 8:28372836-28372858 ACCTAAATGTGCTGTGTGACAGG + Intronic
1040026041 8:42783551-42783573 CCCTTTATATGTGCTATGACTGG + Intronic
1041153490 8:54960427-54960449 CCTTCTAGGTGCTCTCTGACTGG + Intergenic
1042744780 8:72096109-72096131 TCCTTTCTGTGCTCTGTCTCTGG - Intronic
1043854382 8:85247924-85247946 CCTTTTATCTGCTCAGTCACTGG - Intronic
1044723218 8:95170221-95170243 CACTTTATGTTCTCCGTGCCAGG - Intergenic
1045335428 8:101198807-101198829 CCCTTTCTCTGCTCAGTGGCAGG - Intronic
1045919649 8:107514404-107514426 ACCTCTATTTGCTCTGTCACGGG + Intergenic
1046419587 8:113962243-113962265 CTCTTTATGTCCTTTATGACAGG - Intergenic
1046465445 8:114596177-114596199 TGCTTTAACTGCTCTGTGACTGG - Intergenic
1049805693 8:144537795-144537817 TCTTTTATGTGCTGTGTCACTGG + Exonic
1050836550 9:10087630-10087652 TCCTTTGGGTGCTCTGTGAAGGG - Intronic
1062198677 9:135288919-135288941 CCGTAGCTGTGCTCTGTGACTGG + Intergenic
1186998653 X:15151730-15151752 CCCTTTGTGTGGTGTGTGAGTGG + Intergenic
1193298354 X:79858553-79858575 CCCTTTCTGCGCCCCGTGACAGG + Intergenic
1193715007 X:84927377-84927399 CCCTTTAGGAGCTCTGTCCCAGG + Intergenic
1196690180 X:118550680-118550702 ACCTTTCAGTGCTCTGTTACAGG + Intronic
1197738652 X:129872350-129872372 CCCTTCATGTTCTCTGTGTGTGG + Intergenic