ID: 1007522230

View in Genome Browser
Species Human (GRCh38)
Location 6:42459779-42459801
Sequence GGTTGCACACCCATGGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007522230_1007522235 6 Left 1007522230 6:42459779-42459801 CCGAGCTCCATGGGTGTGCAACC No data
Right 1007522235 6:42459808-42459830 ACTAGACCTCAAAATTAGAGGGG No data
1007522230_1007522234 5 Left 1007522230 6:42459779-42459801 CCGAGCTCCATGGGTGTGCAACC No data
Right 1007522234 6:42459807-42459829 AACTAGACCTCAAAATTAGAGGG No data
1007522230_1007522233 4 Left 1007522230 6:42459779-42459801 CCGAGCTCCATGGGTGTGCAACC No data
Right 1007522233 6:42459806-42459828 CAACTAGACCTCAAAATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007522230 Original CRISPR GGTTGCACACCCATGGAGCT CGG (reversed) Intergenic
No off target data available for this crispr