ID: 1007524184

View in Genome Browser
Species Human (GRCh38)
Location 6:42476776-42476798
Sequence GTAGAGAAGAAGAATGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007524184_1007524186 1 Left 1007524184 6:42476776-42476798 CCAGCCTCATTCTTCTTCTCTAC No data
Right 1007524186 6:42476800-42476822 GATAACCCAGATCATGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007524184 Original CRISPR GTAGAGAAGAAGAATGAGGC TGG (reversed) Intergenic
No off target data available for this crispr