ID: 1007533544

View in Genome Browser
Species Human (GRCh38)
Location 6:42564279-42564301
Sequence TCTCCGGGCGGCGGTAGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007533537_1007533544 4 Left 1007533537 6:42564252-42564274 CCGCCGGGGCCGAGGTGAGGCTG 0: 1
1: 0
2: 1
3: 25
4: 227
Right 1007533544 6:42564279-42564301 TCTCCGGGCGGCGGTAGCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 70
1007533539_1007533544 -5 Left 1007533539 6:42564261-42564283 CCGAGGTGAGGCTGCAGCTCTCC 0: 1
1: 1
2: 2
3: 50
4: 371
Right 1007533544 6:42564279-42564301 TCTCCGGGCGGCGGTAGCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 70
1007533530_1007533544 29 Left 1007533530 6:42564227-42564249 CCTGGGGCAGGGGTGGCAGTCGA 0: 1
1: 0
2: 2
3: 33
4: 309
Right 1007533544 6:42564279-42564301 TCTCCGGGCGGCGGTAGCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 70
1007533538_1007533544 1 Left 1007533538 6:42564255-42564277 CCGGGGCCGAGGTGAGGCTGCAG 0: 1
1: 0
2: 3
3: 47
4: 449
Right 1007533544 6:42564279-42564301 TCTCCGGGCGGCGGTAGCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007533544 Original CRISPR TCTCCGGGCGGCGGTAGCGC TGG Exonic