ID: 1007536026

View in Genome Browser
Species Human (GRCh38)
Location 6:42589700-42589722
Sequence TTGTTTGTACTCATTTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 719
Summary {0: 1, 1: 0, 2: 1, 3: 66, 4: 651}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007536026 Original CRISPR TTGTTTGTACTCATTTTTGA AGG Intronic
901353650 1:8622822-8622844 TTGTTTTTTATCATTTTTAATGG - Intronic
902148254 1:14421191-14421213 TTGTTTGCCCTCATTATTCAGGG + Intergenic
904903561 1:33877024-33877046 TAGTTTATACTCATTTTTCAGGG - Intronic
905059732 1:35129538-35129560 TTGTTTGTGTCCATTTTTGTTGG - Intergenic
905330256 1:37190018-37190040 TTGTTTGTAGTAATTTAAGATGG + Intergenic
906438713 1:45821202-45821224 TATTTTTTCCTCATTTTTGAAGG + Intronic
906857695 1:49326203-49326225 TTGTTTACTTTCATTTTTGAAGG + Intronic
907669867 1:56464924-56464946 ATATTTGTACTGAGTTTTGAAGG + Intergenic
907786023 1:57613619-57613641 TTTTTCGTATTTATTTTTGAGGG - Intronic
908157246 1:61366600-61366622 TAAGTTGTTCTCATTTTTGAAGG + Intronic
908449038 1:64232374-64232396 TTATTTGTATTCATTATTGGTGG + Intronic
908849371 1:68359330-68359352 ATGTTTGGAAACATTTTTGATGG + Intergenic
909427414 1:75542580-75542602 TTTTTTGTAGTTATTATTGAAGG + Intronic
909658083 1:78053131-78053153 CTTTTTCTACTCAATTTTGACGG - Intronic
910036098 1:82790921-82790943 TAGCTTGTACTCATGTTTGGTGG - Intergenic
910574120 1:88739140-88739162 TTCTTTGTACTATTTTTTGTTGG + Intronic
910785662 1:90995743-90995765 TTTTTTCACCTCATTTTTGAAGG - Intronic
910989066 1:93036359-93036381 ATATTTGAACTGATTTTTGATGG + Intergenic
911112632 1:94207411-94207433 TCTTTTGTACTTTTTTTTGAAGG - Intronic
911928153 1:103863760-103863782 TTGTTTTTAGTGATTTTTGTGGG - Intergenic
911938975 1:104018477-104018499 TTGTTTGTACCCATGTTTCTTGG + Intergenic
912173487 1:107129258-107129280 TTGTTTTTGCTCTTTTTTGGGGG + Intergenic
912253275 1:108032791-108032813 TTGTTTTCACTCTTGTTTGATGG + Intergenic
912445466 1:109732755-109732777 TCATTTGTATTCATTGTTGAAGG - Intronic
913060445 1:115200346-115200368 TTGTTTGTGGTCATTTTTTCAGG - Intergenic
914402819 1:147339411-147339433 TTGATTGTCCTCATTTATCAGGG + Intergenic
915782764 1:158571121-158571143 TTGTTTGTGCTTATGTATGAGGG + Intergenic
915811032 1:158910507-158910529 TTGTTTGTACCCATTCTTCTTGG - Intergenic
915971202 1:160356471-160356493 TTCTTTCTTCTCATATTTGATGG + Intronic
916164916 1:161958026-161958048 TTGTTTCTTCCCATTGTTGAAGG + Intronic
917042759 1:170824287-170824309 TTGTCTGGAGTCATTTTTTACGG + Intergenic
917114739 1:171591565-171591587 TTGTTCTTTCTCATTTTTTAAGG + Exonic
917185069 1:172344436-172344458 TTGTTTTAACACATTTGTGAAGG - Intronic
918030678 1:180805999-180806021 TTCTTTTTCATCATTTTTGATGG + Intronic
918388395 1:184034369-184034391 TAGTTTGAACTCAGTTTTGAAGG - Intronic
918421517 1:184368811-184368833 TTGTTTGATTTCATTTTTGTGGG - Intergenic
919310565 1:195901537-195901559 TTGTTTGTTCTGGTGTTTGAGGG + Intergenic
919443219 1:197666619-197666641 TTGTTTGCAATCAGTTTTGTAGG - Intronic
919619124 1:199845560-199845582 TTGAATTTACTTATTTTTGAAGG - Intergenic
919722401 1:200852336-200852358 TTGCCTGTCCTCTTTTTTGATGG + Intronic
919964373 1:202507073-202507095 ATGTTTAAGCTCATTTTTGAGGG + Intronic
921559720 1:216642702-216642724 TTCTTTGTTCTGCTTTTTGAAGG + Intronic
922050863 1:221989518-221989540 TTTTTTTTTTTCATTTTTGAGGG - Intergenic
922893849 1:229084625-229084647 TTCTTTTTTCTCATTTCTGAAGG + Intergenic
922992005 1:229922053-229922075 TTTTTTGAAGTTATTTTTGAAGG + Intergenic
923066628 1:230523802-230523824 TTGTTTGGAATCATTTCAGAAGG + Intergenic
923226861 1:231946054-231946076 TTGTTTGGAATCATTTCAGAAGG - Intronic
923377199 1:233376303-233376325 ACATTTGTACTCAGTTTTGAAGG - Intronic
923515405 1:234694005-234694027 TTGGTTGTCCTCAGTATTGAAGG + Intergenic
923963741 1:239112600-239112622 TTGTTTGTTCTCATTTGAGTGGG - Intergenic
924059249 1:240154634-240154656 TTGTATTTACTCATTTTTAAAGG + Intronic
924198542 1:241636925-241636947 CTGTTTGTTCTTATTTTTGAAGG + Intronic
1064696661 10:17974385-17974407 TTGTTTGTACTCACTGTTCTTGG + Intronic
1064758202 10:18591326-18591348 TTGTTTGGAATCATTTCAGAAGG - Intronic
1064801281 10:19075679-19075701 TTGTCTGTACTCCTTTCTGAAGG - Intronic
1065246326 10:23762212-23762234 TTGTTTGGAATCATTTCAGAAGG - Intronic
1065459684 10:25946325-25946347 ATTTTTTTTCTCATTTTTGAAGG + Intronic
1065666263 10:28065166-28065188 TTGTTTTTATTCAATTATGATGG + Intronic
1065693983 10:28362677-28362699 GTGTATGTACTCTTTTTTGACGG - Intergenic
1066327711 10:34381486-34381508 TAGTTTGCACTCAACTTTGAAGG + Intronic
1066447482 10:35496958-35496980 TTGTTTTTGCTGATTTTAGATGG + Intronic
1066550405 10:36549895-36549917 GTCTTTATACTCATTTTAGAAGG - Intergenic
1067680604 10:48435743-48435765 TTCTTTTTACTTATTTTTGTTGG - Exonic
1068196437 10:53723498-53723520 TGGTTTATACTTATTTTTAATGG - Intergenic
1068392251 10:56413775-56413797 TTGTTTGTACTCATCCTTCTTGG + Intergenic
1069053372 10:63817782-63817804 TAATTTGTACTCAAATTTGATGG + Intergenic
1069667706 10:70174621-70174643 TTGTTTGGACTATCTTTTGAAGG - Intergenic
1070740061 10:78897171-78897193 TTGTTTGTTTTGTTTTTTGATGG - Intergenic
1071020350 10:81046824-81046846 TTGTTTGTAATATTTTCTGATGG + Intergenic
1071068982 10:81669769-81669791 TTTTTTGTACCCATGTTTGGTGG - Intergenic
1071819834 10:89268630-89268652 TTTTTTGAAATCATTTTTAATGG + Intronic
1071863107 10:89696159-89696181 TTGATTTTACACATTTTTGAGGG - Intergenic
1072301009 10:94062280-94062302 TTGTTTTTTTTCATTTTTGGAGG + Intronic
1073585301 10:104704341-104704363 TTGTTTGTTTTAATTTTTTAGGG + Intronic
1073831851 10:107393715-107393737 TTGTTGGTAGTGATTTTTGAAGG + Intergenic
1073890231 10:108092081-108092103 TTGTTTGTACTCATTCTTCTCGG - Intergenic
1074155089 10:110791500-110791522 TTATTTGAACTCATCTGTGAAGG + Intronic
1075830442 10:125406739-125406761 TTGTTTGTACCCATCTTTCTTGG + Intergenic
1076037561 10:127213442-127213464 TGGTTTGGAATCATTTTTGGGGG + Intronic
1076310440 10:129502530-129502552 TTTTTTTTACTCATTTTTTAAGG - Intronic
1076430886 10:130401373-130401395 TTTAATGTACTCATTTTGGATGG - Intergenic
1077427619 11:2491127-2491149 TTGTTTGTACCCATCTTTCTTGG - Intronic
1077619992 11:3712649-3712671 TTCTTTGTACTAGTTTTAGACGG + Exonic
1078204063 11:9212695-9212717 TAATTTGCCCTCATTTTTGAAGG - Intronic
1078949272 11:16110910-16110932 TTTGTTGTACTCAGATTTGATGG + Intronic
1079572009 11:21954040-21954062 TTGTTTGTACTCATCCTTCTGGG - Intergenic
1079892730 11:26077965-26077987 TAGTTTATAGTCATTTTTGGGGG - Intergenic
1080084076 11:28258006-28258028 TTGTTTGTACCCATCTTTCTTGG + Intronic
1080149823 11:29038398-29038420 TTTTTTTTTCTCCTTTTTGAGGG + Intergenic
1080796548 11:35568621-35568643 TTGTTTGTACTCATCCTTCTTGG - Intergenic
1080838921 11:35966458-35966480 TTTTATGTACACATTTTTAAAGG - Intronic
1080925396 11:36750892-36750914 GTGTTTGTAGTCATTTGTTATGG - Intergenic
1080965995 11:37216284-37216306 TTGTTTGTACTTATTTTTCTCGG + Intergenic
1081183629 11:40015212-40015234 TTGTCTGTTCTCACTATTGATGG - Intergenic
1082114615 11:48314960-48314982 TTGTTTGTACTCATCTTTCTTGG + Intergenic
1082823787 11:57562864-57562886 TTGTTTGTACTCATCCTTCTTGG - Intronic
1082909338 11:58352876-58352898 TTGTTTGACCTCATTTTGAAAGG - Intergenic
1083293301 11:61701624-61701646 TTGTTTGTTCTCACATTCGAGGG + Intronic
1083507864 11:63176983-63177005 TTATTTCTCTTCATTTTTGAAGG + Intronic
1083528685 11:63396989-63397011 TTGTTTGTACACATCTTTCTTGG + Intronic
1084872097 11:72105267-72105289 GTGTATGTACACATTTGTGAAGG + Intronic
1085672629 11:78482834-78482856 TTGTTTGGAATAATTTTAGAAGG - Intronic
1086464754 11:87041591-87041613 ATGATTGTACCCATTTTTTAAGG + Intronic
1087380322 11:97397778-97397800 TTGTTTGTACTCATCCTTCTTGG + Intergenic
1087524371 11:99290407-99290429 TTGTGTTTACTCAATTTTGTGGG - Intronic
1087696714 11:101386872-101386894 TATTTTGCCCTCATTTTTGAAGG + Intergenic
1087751974 11:102016799-102016821 CTGTTTGTACTTTTTTTTGGTGG - Intergenic
1088112892 11:106282247-106282269 TTCTTTTTAGTCATTTTTGCAGG - Intergenic
1088181974 11:107122426-107122448 TTGTTTGTACCCATTCTTTTTGG - Intergenic
1091140868 11:133233459-133233481 TTGTTTGTACTAATTTACCATGG - Intronic
1091256371 11:134190365-134190387 TTGTTGTTACTGATTTTTAATGG + Intronic
1091270179 11:134304916-134304938 TTATTATTACTCATCTTTGATGG + Intronic
1091533950 12:1387801-1387823 TTGTTTGTGATCATTTCTTACGG + Intronic
1091547553 12:1512307-1512329 TTGTTTGTCCTTATCGTTGATGG - Intergenic
1092854289 12:12658010-12658032 TTTCTTGTACTCCTGTTTGAAGG + Intergenic
1094252340 12:28378389-28378411 TTGTTTGTACCGTTTTATGAAGG + Intronic
1095186715 12:39208758-39208780 TGGTTTCTACTCATCTTTGTGGG - Intergenic
1095480208 12:42626756-42626778 TTGTTTTTCCCCATTTTTTACGG - Intergenic
1096861517 12:54532101-54532123 TTATTTCTACCTATTTTTGAAGG + Intronic
1096930440 12:55202456-55202478 TTGTTTGTAATACTTTTTGAAGG - Intergenic
1097347865 12:58514752-58514774 TAGTCTCTAATCATTTTTGATGG + Intergenic
1097568178 12:61297103-61297125 TTGTTTGTAGTAATCTCTGATGG - Intergenic
1097569267 12:61311387-61311409 TTGTTTTAATTTATTTTTGAGGG - Intergenic
1097770079 12:63572967-63572989 TTGTTTGTACCCATCCTTGTTGG - Intronic
1097891834 12:64784485-64784507 TTGGATCTACTCATTTTTAAAGG - Intronic
1097965898 12:65580970-65580992 TTGTTTATAGCCATTTTTGCAGG - Intergenic
1098201498 12:68061039-68061061 TTGTTTGAAATAATTTTAGAAGG + Intergenic
1098432877 12:70439476-70439498 ATGTATGTACACATTTTTGTGGG - Intergenic
1098491888 12:71092151-71092173 TTGTTTGTACTCATTCTTCTTGG + Intronic
1099015046 12:77334433-77334455 TTGTTTGTTCTCAATTCTAAAGG - Intergenic
1099185718 12:79513780-79513802 TTGTTCCTACTCCTTTCTGATGG + Intergenic
1099611866 12:84883216-84883238 TTGTTTGTTATTATTTTTAAAGG - Intronic
1099702392 12:86103577-86103599 TTGTTTGTACCAATTTGTTATGG + Intronic
1100048616 12:90415656-90415678 TTTTTTTTTCTCTTTTTTGATGG - Intergenic
1100909032 12:99337617-99337639 TTGTTTGTACCCATTCTTCTTGG + Intronic
1102077816 12:110073874-110073896 TTTTTTGGACTCATTTCTGTTGG + Intergenic
1102829148 12:115979770-115979792 TTGTGGGAACTGATTTTTGAAGG + Intronic
1103057838 12:117835649-117835671 GTGTCTGTAGGCATTTTTGATGG + Intronic
1103354053 12:120306476-120306498 TTGTTTGTTTTTTTTTTTGACGG - Intronic
1103434760 12:120916215-120916237 TGTTTTGTCTTCATTTTTGAAGG + Intergenic
1103924517 12:124416249-124416271 TTTCTTTTGCTCATTTTTGATGG - Intronic
1104515002 12:129417096-129417118 TTGTTTGGAATCATTTCAGAAGG + Intronic
1105336248 13:19472828-19472850 TTGTTTGTACCCATCTTTCTTGG + Intronic
1106531345 13:30595410-30595432 GTGTCTGAACTCATTTTTGTAGG - Intronic
1107159358 13:37208078-37208100 TATTTTGTTTTCATTTTTGAAGG + Intergenic
1107455489 13:40550782-40550804 CTTTTTAGACTCATTTTTGATGG - Intergenic
1108290734 13:48958035-48958057 TTCTTTGTTTTCATTTTTGAGGG - Intergenic
1108858162 13:54820942-54820964 TTGTTTGTACCCATTCTTTTTGG - Intergenic
1109345516 13:61110873-61110895 TAATTTGCACTCATTTTTTATGG - Intergenic
1109977615 13:69859673-69859695 TTGTTTCTAAACATTTCTGAGGG - Intronic
1110117036 13:71831486-71831508 ATGTTAGGACTCATTTTAGAGGG - Intronic
1110769816 13:79328896-79328918 TAGTTTGTCCTCATTTTTATCGG - Intronic
1110776788 13:79416963-79416985 TTGTTTGTACTCATTGTCCCAGG + Intergenic
1110901042 13:80824931-80824953 TTGTATGTTCTCATTTATAATGG - Intergenic
1110916652 13:81030000-81030022 TTGTTTGTACCCATTCTTCTTGG + Intergenic
1111056395 13:82956226-82956248 TTGTTTGGAATCATTTCAGAAGG - Intergenic
1111235768 13:85405802-85405824 TTGTGTGTCCTGATTTTTCAGGG - Intergenic
1111513186 13:89293438-89293460 TTGTTTGTACTCATCCTTCTTGG + Intergenic
1111717293 13:91895526-91895548 GTTTTTGTAGTCATTTCTGATGG + Intronic
1112840666 13:103573521-103573543 TAGCTTGTACTCACATTTGACGG - Intergenic
1114133208 14:19817239-19817261 TTGTTTGTAATAGTTTCTGAAGG + Intronic
1114134854 14:19835493-19835515 TGGTTTTTTCTCATTTTTGTGGG - Intergenic
1114410927 14:22499787-22499809 TTGTTGGTGTTCATGTTTGAGGG + Intergenic
1114757231 14:25273232-25273254 TTGTTTATCATTATTTTTGATGG - Intergenic
1114762631 14:25333292-25333314 TTGTTTATAATAATCTTTGAAGG - Intergenic
1115122006 14:29948529-29948551 ATGTATGTTCTCATTTTTGGGGG - Intronic
1115416440 14:33140224-33140246 TTGTTTTTCCTCATTTTCGTGGG - Intronic
1115834207 14:37379506-37379528 TTGTTTTCTCACATTTTTGATGG - Intronic
1116247360 14:42433073-42433095 TTGTTTGGAATCATTTCAGAAGG - Intergenic
1116276917 14:42846417-42846439 TTATTTGTAGCCATTTTGGAGGG + Intergenic
1116354966 14:43915722-43915744 TTGTTTGTACTCATCCTTCTTGG - Intergenic
1116534191 14:46010321-46010343 TTATTTGTGTTCATTTTCGAGGG + Intergenic
1116994767 14:51311377-51311399 TTCTTGGTACTCATTTTTCCTGG + Intergenic
1117029720 14:51655556-51655578 TTGTTTCTACTTACTTTTAAAGG - Intronic
1117950325 14:61076226-61076248 TTGTTTCTACTCTTTTTCCATGG - Intronic
1118669956 14:68113994-68114016 TTGTTTGTACTGAATGTTGGTGG - Intronic
1119072077 14:71596766-71596788 TTGTTGGAACTCTGTTTTGATGG + Intronic
1120470284 14:84914908-84914930 TTGTTTGTACAGATTTTTCTTGG + Intergenic
1121036703 14:90711006-90711028 TATTTTTTCCTCATTTTTGAAGG - Intronic
1121290049 14:92766782-92766804 TTCTTTTTATTCATTTTTAAAGG + Intergenic
1121385557 14:93520136-93520158 TATTTCATACTCATTTTTGAAGG + Intronic
1122147707 14:99702780-99702802 TAGTTTGTAGTCATTGTTCATGG - Intronic
1122796331 14:104207950-104207972 ATGTTTTTACCCATTTTTAATGG - Intergenic
1202832757 14_GL000009v2_random:54790-54812 TTATTTTTACTTATTTTAGATGG + Intergenic
1123576295 15:21673041-21673063 TTGTTTGTAATAGTTTCTGAAGG + Intergenic
1123612918 15:22115509-22115531 TTGTTTGTAATAGTTTCTGAAGG + Intergenic
1123633986 15:22284365-22284387 TTGTTTTTTATCATTTTTAATGG + Intergenic
1124553592 15:30706236-30706258 CTGTTTGTCCTCATTGTTTATGG - Intronic
1124677653 15:31699432-31699454 CTGTTTGTCCTCATTGTTTATGG + Intronic
1125467076 15:39964430-39964452 ATGTCTGCACACATTTTTGATGG + Intronic
1126017585 15:44367416-44367438 TATTTTATTCTCATTTTTGAAGG + Intronic
1126396768 15:48226627-48226649 TTTTTTATACTTCTTTTTGATGG + Intronic
1126438629 15:48663138-48663160 TTATTTGTAATAATTTTTAAAGG + Intergenic
1127781955 15:62324281-62324303 TTCTTTCAACTCAGTTTTGAAGG + Intergenic
1127808385 15:62541836-62541858 ATGTTTGTTTTCATTTTGGATGG + Intronic
1128364626 15:66989033-66989055 TTGTTTGTACTCATCCTTCTTGG - Intergenic
1129626755 15:77208955-77208977 TCCATTGTACTAATTTTTGAAGG + Intronic
1132063004 15:98708054-98708076 GTAGTTGTACTCATTGTTGATGG - Exonic
1132324828 15:100959960-100959982 TTCCTTGCACTCATTTTTGTTGG + Intronic
1202985163 15_KI270727v1_random:407286-407308 TTGTTTGTAATAGTTTCTGAAGG + Intergenic
1137045943 16:35661811-35661833 TTGTTTGTACTTTTTATTGCAGG - Intergenic
1137914736 16:52416951-52416973 TTGTTTTTCTTCCTTTTTGAAGG + Intergenic
1140036152 16:71372759-71372781 ATGTTTGGAGACATTTTTGATGG - Intronic
1140220515 16:73040410-73040432 TTGTTTGTAGTGATTTGTGGAGG - Intronic
1140496852 16:75396916-75396938 TTGTTTGTTTTCATTTGAGATGG + Intronic
1140558641 16:75951143-75951165 TAATTTGTACTCATCTTTGGGGG - Intergenic
1140635278 16:76905563-76905585 TAATTTGTGGTCATTTTTGATGG + Intergenic
1140907814 16:79424551-79424573 TTGTTTCTTCTGATTTTTAAAGG + Intergenic
1141949501 16:87331502-87331524 TTGTTTCTGCTCAGTTTTTATGG - Exonic
1142055934 16:87995996-87996018 TTGTTTAAACTCATCTTTGGAGG + Intronic
1143880753 17:10027887-10027909 TTGTTTGTTTTGTTTTTTGACGG + Intronic
1144336566 17:14276558-14276580 TTGTTTGTTTTGATTGTTGAAGG + Intergenic
1144579189 17:16448454-16448476 TCATTTGTTCTCACTTTTGAGGG - Intronic
1146818158 17:35961415-35961437 TTATTTTTTCTCAATTTTGAAGG - Intergenic
1149111167 17:53032842-53032864 TTGTTTGTACTCATCCTTCTTGG + Intergenic
1149218661 17:54389233-54389255 TTGTCTGTACCCATGTTTGGTGG - Intergenic
1150197939 17:63320609-63320631 TTATTTTTTCTCAATTTTGAAGG + Intronic
1150628512 17:66859248-66859270 CTTTTTGTACTCATGTTTGTGGG + Intronic
1150924068 17:69514210-69514232 TTGCTTGTACTAATTTGTAATGG - Intronic
1151808387 17:76421002-76421024 GTGTTTGTATTTATTTTTGTTGG - Intronic
1151881393 17:76897297-76897319 TGGTTTGTGGTCATTTTTTACGG - Intronic
1152004274 17:77668577-77668599 TTGTTTGTGTTCATTTTTAAAGG + Intergenic
1153835538 18:8960568-8960590 TGATTTGTACTCAATTTTTAGGG + Intergenic
1154223763 18:12481482-12481504 TAATTTCTACTTATTTTTGAAGG + Intronic
1154300987 18:13192255-13192277 TTATTTGTGCACATTTTTGTGGG - Intergenic
1154422651 18:14248200-14248222 TTATTTTTACTTATTTTAGATGG + Intergenic
1154459235 18:14563108-14563130 TTGTTTGTAATAGTTTCTGAAGG + Intergenic
1155122376 18:22835102-22835124 TACTTTGTCTTCATTTTTGAAGG - Intronic
1155470392 18:26185840-26185862 TTATTTGTTTTCATTTTTAATGG + Intronic
1156094396 18:33511273-33511295 TTGTTTGTACTCATCTTTCTTGG - Intergenic
1157979165 18:52360890-52360912 TTGTTTTTACTCATGATTGGAGG + Intronic
1158039162 18:53071712-53071734 TTGTTTTAATTAATTTTTGAAGG + Intronic
1159284785 18:66335822-66335844 TTGTTTGTACTCATCCTTCTTGG + Intergenic
1159446668 18:68549355-68549377 TTGGTTGCATTCATTTTTCAGGG - Intergenic
1160213646 18:76906713-76906735 TTGTTTGTCATCAGTTTCGAGGG + Intronic
1162692833 19:12448253-12448275 TTGTTTGTACTCATCCTTGTTGG + Intronic
1162921753 19:13906989-13907011 TTGATTTTTCTCAGTTTTGATGG + Intronic
1163354021 19:16797977-16797999 TTGCCTGCACTCATTTTTGTGGG - Intronic
1163816541 19:19468716-19468738 TTTTTTGCTTTCATTTTTGAAGG - Intronic
1163990196 19:20991791-20991813 TTGTTTGAAATCATTTCAGAAGG - Intergenic
1164380077 19:27727401-27727423 TTGTTTGTAATTTTTATTGAGGG + Intergenic
1164392317 19:27835635-27835657 TTGTTTGTAGTCATTGTTCTTGG - Intergenic
1164545701 19:29160689-29160711 TTGTTTGCCCACATTTTTGATGG - Intergenic
1164665346 19:30029001-30029023 ATTTTTGTCCTCTTTTTTGAAGG + Intergenic
1166854967 19:45778824-45778846 TTGTTTGTGTTTTTTTTTGAGGG - Intronic
1166964579 19:46520943-46520965 TTGTTAGTAGCCATCTTTGAAGG + Intronic
1168221963 19:54966846-54966868 TTTTTTCTTCTCTTTTTTGAGGG + Intronic
1168318381 19:55494122-55494144 GTGTTTGGAAACATTTTTGATGG + Intronic
1168360222 19:55733429-55733451 TTCTTTATACTCATTTTTCATGG + Exonic
1202639925 1_KI270706v1_random:72936-72958 TTATTTTTACTTATTTTAGATGG - Intergenic
925651666 2:6096789-6096811 TTATTTCTACTAATTTTTTAGGG + Intergenic
925698803 2:6612667-6612689 TTGTTTGTACCCATCTTTCTTGG + Intergenic
926391514 2:12398615-12398637 TTGTTTATATTCATATATGAGGG - Intergenic
926531186 2:14047892-14047914 TTAATTGTACTCATGTTTTATGG + Intergenic
926834249 2:16999831-16999853 TTATTTTCATTCATTTTTGAGGG + Intergenic
926995730 2:18733763-18733785 TTGTTTGGAATCATTTCAGAAGG - Intergenic
927530369 2:23792389-23792411 TTGTTAGTCCCCAGTTTTGAAGG + Intronic
927558654 2:24053452-24053474 TTGTGTTTATTCATCTTTGATGG + Intronic
927950708 2:27166832-27166854 TTGGTTTTACACATTTTAGAGGG - Intergenic
928459028 2:31452024-31452046 TTGTTTGTACCCATTCTTCTTGG - Intergenic
928757286 2:34542673-34542695 TGGTTTGTACTTCTTCTTGAAGG + Intergenic
928769548 2:34690417-34690439 TAGTATGCACTCTTTTTTGATGG - Intergenic
929072470 2:38047092-38047114 TATTTTGTCTTCATTTTTGAAGG - Intronic
929342324 2:40836336-40836358 TTGTTGTTGCTCTTTTTTGAGGG - Intergenic
930141762 2:47957815-47957837 TTATTTCTCCTCATGTTTGAAGG - Intergenic
930300557 2:49610478-49610500 TTTTCTGTACACATTTTTAATGG - Intergenic
930676723 2:54209507-54209529 TTGTTTGGACTCATTTTCTTTGG + Intronic
930893091 2:56413515-56413537 TTGGTTGTTCTCATTTGGGAAGG + Intergenic
930895313 2:56439688-56439710 TTGTTTGTACTCATCTGTCTTGG + Intergenic
931675769 2:64694873-64694895 TGTTTTGTCTTCATTTTTGAAGG + Intronic
931736104 2:65196085-65196107 TTTTATGTACACATTTTTAAGGG - Intergenic
932304112 2:70689498-70689520 TTGTTTGTAGTACTTTTTGTGGG - Intronic
932653401 2:73584857-73584879 TTGTATGTTCTCATTTATAACGG - Intronic
932992411 2:76803809-76803831 TTGTTTGTACAGATGTTTCAGGG - Intronic
933021059 2:77192708-77192730 TTGTTTTTACTGAATTTGGATGG + Intronic
933387977 2:81635251-81635273 TTGTTTGTACCCATCTTTCTTGG - Intergenic
933529634 2:83490524-83490546 TTGTTAGTTCTTATCTTTGAAGG - Intergenic
933549080 2:83751978-83752000 TTCTATGTACTCATCTTTAATGG - Intergenic
933995244 2:87663394-87663416 TTTTGTTTACTCAGTTTTGATGG + Intergenic
934495411 2:94792355-94792377 TTATTTTTACTTATTTTAGATGG - Intergenic
935478464 2:103556118-103556140 TTGTTTGTACCCATTATTCTTGG + Intergenic
935506789 2:103915466-103915488 TTTTTTATAATCTTTTTTGATGG + Intergenic
935558269 2:104534318-104534340 TTATTTGTACTGCATTTTGAGGG - Intergenic
935676319 2:105597671-105597693 TTGTTAGTCCTCAATTTGGAGGG - Intergenic
936256142 2:110914824-110914846 TTGTTTGTTTTAATTTTTGTGGG + Intronic
936298616 2:111287519-111287541 TTTTGTTTACTCAGTTTTGATGG - Intergenic
936952568 2:117992893-117992915 TTTTTTCTTCTCATTTTTAATGG - Intronic
937736395 2:125296235-125296257 TTGCTTGTACCCATTCTTGTTGG + Intergenic
938136507 2:128762754-128762776 TTGTTTGGAATAATTTCTGAAGG + Intergenic
938279648 2:130054952-130054974 TTGTGTCTAATCATTTGTGAAGG + Intergenic
938330596 2:130445662-130445684 TTGTGTCTAATCATTTGTGAAGG + Intergenic
938359348 2:130675841-130675863 TTGTGTCTAATCATTTGTGAAGG - Intergenic
938435748 2:131282490-131282512 TTGTGTCTAATCATTTGTGAAGG - Intronic
938707756 2:133947739-133947761 TTGTTTTTTCACCTTTTTGATGG - Intergenic
938835432 2:135098189-135098211 TTGTTTGTTTTCTTTTTTGGGGG + Intronic
939144658 2:138397367-138397389 TTGTTTGTACTCATTCTTCTTGG - Intergenic
939369004 2:141273765-141273787 TTGTTTATTCACTTTTTTGATGG - Intronic
940087606 2:149878662-149878684 TTGTTTCTGTTCATTTTTAAGGG - Intergenic
940621022 2:156113908-156113930 TTATTTCTACTGATATTTGATGG + Intergenic
940684780 2:156833402-156833424 ATATTTGTACTCATTTATGGGGG - Intergenic
940717922 2:157248732-157248754 TTAATTGTAGTCATTTTTGTGGG - Intergenic
940761028 2:157739513-157739535 TTGTTTGAACCCTTTGTTGAGGG - Intronic
940764365 2:157773875-157773897 TTCTCTGTACTCATTAGTGATGG + Intronic
941208795 2:162609674-162609696 TGGTTTTTCCTCCTTTTTGAAGG + Intronic
941450579 2:165655588-165655610 TTGTTTGTCGTCATTTTTACGGG - Intronic
941493275 2:166169050-166169072 TTGCTTGTTCTCATTTTTGTTGG - Intergenic
941621031 2:167779216-167779238 TTCTTTCTACACATTTTTGGAGG + Intergenic
941745820 2:169086611-169086633 TTGTTTGTACTCATCCTTCTGGG + Intronic
941822714 2:169858491-169858513 TTATTTCTCCTCAGTTTTGAAGG + Intronic
941839432 2:170064626-170064648 TTTTTTGGACTGATTTTTCATGG + Intronic
942391649 2:175501776-175501798 TTGTTTGTGCTCATTCTTCTTGG + Intergenic
942795016 2:179807592-179807614 CTTTTTTTACTCTTTTTTGAGGG - Intronic
943399472 2:187388311-187388333 TTTTTTGTACACATTTTTTGTGG + Intronic
944000151 2:194824754-194824776 TTGCTTGTACTAATTTATAACGG + Intergenic
944771014 2:202914159-202914181 TGGTTGGTAATCATTTTTTATGG + Intronic
944930469 2:204513501-204513523 TTCTTTATTCTCATTTTTAATGG + Intergenic
944951870 2:204760318-204760340 TTGCTTGTATTGATTTTTGTGGG + Intronic
945128632 2:206541676-206541698 TTGTTTATAATCATTTTTAATGG - Intronic
945210374 2:207376093-207376115 TTGTTTGTACTCATCCTTCTTGG - Intergenic
945468492 2:210199733-210199755 GTTTTTGTATTCATTTTTGTGGG + Intronic
945564434 2:211379123-211379145 TTCTTTGTTGTCATTTTTGGAGG + Exonic
945575805 2:211526498-211526520 TTGTTTGTACTCATTCTTCTTGG - Intronic
945706064 2:213233420-213233442 TTGTTTGTACTGTTTTTTGTTGG - Intergenic
946092108 2:217236497-217236519 GTGTTTGTAGTAGTTTTTGATGG + Intergenic
947172949 2:227329986-227330008 ATGTTTGTATTCATTTTTGGAGG - Intronic
947417563 2:229913631-229913653 TTGCTTGTTTTCATTTTTCAGGG - Intronic
947911542 2:233803968-233803990 CTCTTTGTCCTCATTTTTAAAGG - Intronic
1170489628 20:16859436-16859458 TTCTTTGTCCACATTTTTAAAGG - Intergenic
1170929837 20:20758951-20758973 TTGTTTGTGGTCATGTTTGGTGG - Intergenic
1171353504 20:24524099-24524121 TTGTTTTTACTCATCCTTGGAGG + Intronic
1171938113 20:31294851-31294873 TTGTTTGTACTCGTCTTTCTTGG - Intergenic
1172348888 20:34225802-34225824 TTGTTTTTGTTCATTTTTAATGG + Intronic
1173308924 20:41878591-41878613 ATGTTTTTATTCATTTTTGTTGG + Intergenic
1176648256 21:9370533-9370555 TTATTTTTACTTATTTTAGATGG - Intergenic
1176737302 21:10562255-10562277 TTGTTTGTACCCATCTTTCTTGG - Intronic
1176814905 21:13590237-13590259 TTGTTTGTAATAGTTTCTGAAGG - Intergenic
1176850814 21:13911760-13911782 TTATTTTTACTTATTTTAGATGG - Intergenic
1177064506 21:16412770-16412792 TTGTTTATAGTCTTTTCTGATGG + Intergenic
1177105322 21:16947132-16947154 TTGTTTGTATCCATTTTTCCTGG - Intergenic
1177520899 21:22223867-22223889 TTGTTTGAACTAAATTTTTATGG + Intergenic
1177592350 21:23186344-23186366 TTGTTTGTACCCATCTTTCCTGG - Intergenic
1177885723 21:26742879-26742901 ATATTTGTCCTCATTCTTGATGG - Intergenic
1178551894 21:33547503-33547525 TGGTTTGTCCTCTTTTTTGGGGG + Intronic
1178812507 21:35896927-35896949 GTGTTTGGACACATTTTTGATGG + Intronic
1179441574 21:41398494-41398516 TTGCTTGGCCTCATTTGTGAAGG - Intronic
1180362013 22:11908934-11908956 TTATTTTTACTTATTTTAGATGG + Intergenic
1182016344 22:27043281-27043303 TTGTTTGTTTTGATTTTTGCAGG + Intergenic
1183531822 22:38360338-38360360 TTGTTTGTACCCATCTTTCTTGG + Intronic
1183911228 22:41080790-41080812 GTCTTTGTACTCATTAATGAAGG - Intergenic
949743455 3:7263028-7263050 TAGTTATTACTCATTTTTGTGGG + Intronic
950320672 3:12049946-12049968 TTGTTTGTTTTTGTTTTTGAGGG + Intronic
950352533 3:12370769-12370791 TTGTTTTTAATTATTTTTAAAGG + Intronic
950671937 3:14532536-14532558 ATGTTTGGAGTCATTTTTGTTGG - Intronic
951188326 3:19740434-19740456 TTGTTTGTTTTCACTTTGGAAGG + Intergenic
951282496 3:20769853-20769875 TTGTTTGTGCTTAGTTTTGGGGG - Intergenic
951445771 3:22778729-22778751 TTGTTTGTACCAATTTGTGAGGG + Intergenic
951647142 3:24905454-24905476 GTGATGGTACTCATTATTGATGG + Intergenic
951748232 3:26003576-26003598 TTCTTTGTACTCATTGTAAAGGG + Intergenic
951832526 3:26946446-26946468 TTGTTTGGAGTAATTTTAGAAGG - Intergenic
952484949 3:33800370-33800392 TTGTTTGCACCCATTTATGATGG + Intronic
952671260 3:35972317-35972339 TTTTTTTTGTTCATTTTTGAAGG + Intergenic
953229237 3:41049996-41050018 TTGTTTGTACTCATCCTTCTTGG + Intergenic
955121890 3:56068330-56068352 GTGTTTGTACTCTTCTCTGATGG + Intronic
955490204 3:59474257-59474279 TTTTTTTTAATCAGTTTTGATGG + Intergenic
955831798 3:63012611-63012633 TTGTTTGGAATAATTTTGGAAGG + Intergenic
956067027 3:65407540-65407562 TTTGTTGTGCTCATTTTTAATGG - Intronic
956219832 3:66890454-66890476 TTGTGTGTTCTCATTTATTAAGG + Intergenic
956356046 3:68393455-68393477 TTGTTTGAAATAGTTTTTGAAGG - Intronic
957387486 3:79515820-79515842 TGGTATGTAGTCATTTTTAAAGG + Intronic
957601897 3:82347182-82347204 TTGTTGGTATTTTTTTTTGATGG + Intergenic
957996281 3:87693598-87693620 TTTTTTTTTTTCATTTTTGATGG - Intergenic
958131169 3:89426028-89426050 TTTGTTTTGCTCATTTTTGATGG + Intronic
958147253 3:89641065-89641087 TTGTTTGTATCCATTTTTCTTGG - Intergenic
958719335 3:97824725-97824747 TTGATTGTACTCATATTAGGTGG + Intronic
959563773 3:107813560-107813582 TTGCTTGTACATATTTTTCAGGG - Intergenic
959616156 3:108349587-108349609 TTGTTTGGAATCATTTCAGAAGG - Intronic
959635837 3:108568327-108568349 TTGCTTTTAATCATTTGTGATGG - Intronic
959861882 3:111225750-111225772 TTCTTTGTGCTCATTCTTGTGGG + Intronic
960122500 3:113961197-113961219 TTGTTTGAAATCATGTTCGAGGG - Exonic
960466977 3:118008222-118008244 TTGTTTGAAATCATTTCAGAAGG + Intergenic
960813121 3:121644171-121644193 TTCTTTGAACTCATTTTTTATGG - Intronic
961230052 3:125297871-125297893 GTGTATGTACTCATTTCTGTTGG - Intronic
961268253 3:125665791-125665813 TTGCTTGTTTTTATTTTTGAGGG + Intergenic
962410904 3:135141156-135141178 TTTTTTTTTCTCTTTTTTGATGG + Intronic
963680236 3:148365207-148365229 TTGTTTGTATACATTTTTCTTGG + Intergenic
964073867 3:152669278-152669300 GTGTTTGTACACATTGTTGGTGG - Intergenic
964224220 3:154378740-154378762 TTGATTGTAGCCATTTTTGTGGG + Intronic
964319999 3:155485786-155485808 TGGTTTATATTCATTTTTCATGG - Intronic
964383411 3:156121202-156121224 TTTTTTGTAGTTATTTTGGAAGG - Intronic
964568879 3:158090617-158090639 TTTTTTGAAGTCATTTTTAAGGG + Intergenic
964759048 3:160115927-160115949 TTGTTTGTACTCATTTTTCTTGG - Intergenic
964987816 3:162766196-162766218 TTCTTTGTACCCACATTTGATGG + Intergenic
965002105 3:162967464-162967486 TTGTTTGGAATCATTTCAGAAGG - Intergenic
966052335 3:175635872-175635894 TTGTTTAAACACATTTTTGGAGG - Intronic
966060836 3:175752977-175752999 TAGTTTGTCCTAAATTTTGATGG - Intronic
966151392 3:176870622-176870644 TTGTTTGTACTCATCCTTCTAGG - Intergenic
966264301 3:178019985-178020007 TTATATATACTCATATTTGAAGG - Intergenic
967353219 3:188538252-188538274 TTGTTTGTTCACTTTCTTGATGG - Intronic
967638949 3:191838099-191838121 TTGTTTGGAATCATTTCAGAAGG - Intergenic
968004836 3:195235639-195235661 TTGTTTGTACTCATCCTTCTTGG + Intronic
968328350 3:197841641-197841663 CTGTTTTTACTTCTTTTTGAAGG + Intronic
1202738630 3_GL000221v1_random:34452-34474 TTATTTTTACTTATTTTAGATGG + Intergenic
968430183 4:553385-553407 TTGTTTCTGCTATTTTTTGATGG + Intergenic
969172869 4:5377929-5377951 TTGTTTTTATTTATTTTTTATGG - Intronic
970011143 4:11460218-11460240 TTGTTTGTACCCATCTTTCTTGG - Intergenic
970108650 4:12613268-12613290 ATGTTTGAACTCATTTATCAAGG + Intergenic
971471614 4:27032466-27032488 TTGGCTGTACTCATCTGTGACGG - Intergenic
971569428 4:28192086-28192108 TTTTTTGGCCTCATTTTTTAAGG + Intergenic
971765397 4:30824415-30824437 TTGAGTGTATTCATTTTTAAAGG - Intronic
971803460 4:31322821-31322843 TTATTTCTATTCATTTTTCAAGG - Intergenic
971932915 4:33108436-33108458 TTGTTTGTTTTCTTTTTTAATGG + Intergenic
971974379 4:33664693-33664715 TTGTTTGGAATCATTTCAGATGG + Intergenic
972383878 4:38544784-38544806 TTGTTCCTATTCATTTTTCAGGG + Intergenic
973066820 4:45805814-45805836 TTGTTTGTAGTAATCTCTGATGG - Intergenic
973088086 4:46094169-46094191 TTTTTTATATACATTTTTGAAGG - Intronic
973370170 4:49239288-49239310 TTATTTTTACTTATTTTAGATGG - Intergenic
973390857 4:49556124-49556146 TTTTTTTTACTTATTTTAGATGG + Intergenic
973854826 4:55000793-55000815 TTTTTTGTCCTCATCTTTGGTGG - Intergenic
974240791 4:59243958-59243980 TTGTTTGTTTTGTTTTTTGAGGG - Intergenic
974417091 4:61622687-61622709 TTGTATCTACCCATTTTTTATGG - Intronic
974707668 4:65542664-65542686 TTGTTTGCAATAGTTTTTGAAGG - Intronic
974938624 4:68437570-68437592 TTTTTTGTACTCCTTTTTTAGGG - Intergenic
975144424 4:70952102-70952124 TTGTGTGTACGCATGTATGAAGG - Intronic
975178248 4:71312365-71312387 TTGTTTGTAATAATTTCAGAAGG - Intronic
975444638 4:74447871-74447893 TCATTTGTGCTTATTTTTGAAGG + Intronic
975912226 4:79280418-79280440 TTGTTTATACTCACTTTTTCTGG + Intronic
976011933 4:80499674-80499696 TTGTTTCTATTAATTTTAGATGG + Intronic
976082681 4:81374508-81374530 TTGTTTGTACCCATCTTTCTTGG + Intergenic
976363485 4:84207188-84207210 TTGTTTGGAATAATTTTAGAAGG - Intergenic
976438617 4:85047140-85047162 TTGTTTGGAATAATTTTAGAAGG - Intergenic
977747803 4:100571831-100571853 TTGTTTGTAAACATTTTGGAAGG + Intronic
977759449 4:100714743-100714765 GTGTTTGTCCTCATTTTAGCAGG + Intronic
978495114 4:109350781-109350803 TTGTTTTTAGTCATTTTAAAGGG - Intergenic
978654518 4:111049951-111049973 TTATTTGTACACATCTTTCATGG - Intergenic
978657171 4:111078147-111078169 TTGTTTGGAATCATTTCAGAAGG - Intergenic
979399454 4:120230655-120230677 TTGTTTGTTCACATTTTGCAGGG + Intergenic
980247935 4:130271598-130271620 TTGTTTGAAGTTATTTATGATGG + Intergenic
980409383 4:132396471-132396493 TTCTTTGAACTCTGTTTTGACGG - Intergenic
980428737 4:132662042-132662064 TTATTTAAATTCATTTTTGAAGG - Intergenic
980463017 4:133142181-133142203 TCTTTTTTACTCATTTCTGAAGG - Intergenic
980701073 4:136431039-136431061 TTTTTTCCACTGATTTTTGAAGG - Intergenic
980806474 4:137821239-137821261 TTTATTGTGCTCATTTTTGTTGG + Intergenic
981297965 4:143155391-143155413 TTGTTTGTACCCATTCTTCTTGG + Intergenic
981488982 4:145319741-145319763 TTTTTATTACTCATTTTTCAAGG - Intergenic
982909711 4:161124386-161124408 TTTTTTGTAAACATTTTGGATGG + Intergenic
982990540 4:162268427-162268449 TTGTTTTTTCCCATTTATGAGGG - Intergenic
983091103 4:163503978-163504000 TTCTTTGTACTAAGTCTTGAAGG + Intronic
983293522 4:165836695-165836717 TTGTTTTTACCCATCGTTGATGG + Intergenic
983302088 4:165938789-165938811 TTTTTTGTACTCCTTTCTGTAGG + Intronic
983398049 4:167227716-167227738 TTTTATGTACTTATTTTTAAAGG - Intronic
983484311 4:168316080-168316102 TTGATTGTCTTCATTCTTGATGG - Intronic
983592494 4:169429325-169429347 TTCTTTGTGCTCATGTATGAAGG + Intronic
984120784 4:175739970-175739992 TTTTTTAAAGTCATTTTTGAAGG - Intronic
984516779 4:180751031-180751053 TTGTTTTGACTCATTTTTTAAGG + Intergenic
985753101 5:1694199-1694221 TTGCTTGTCCTTATTCTTGAAGG + Intergenic
985898751 5:2768928-2768950 TTGTTTGTTTTCTTTTTAGATGG + Intergenic
986524668 5:8660959-8660981 TTGTATGTCCTCATTTTGTAGGG - Intergenic
986631022 5:9774548-9774570 TTGTTTGTACTCATTGTTCTTGG + Intergenic
987002938 5:13679146-13679168 TTATTTTTACTTATTTTTGATGG - Intergenic
987164111 5:15175244-15175266 TTGTTTGTACTCATCTTTCTTGG - Intergenic
987496450 5:18651938-18651960 TTGTTTGTACTCATGCTTCTTGG + Intergenic
987800070 5:22684159-22684181 TTTTTTTTCCTAATTTTTGAGGG + Intronic
987904020 5:24051720-24051742 TTGTTTGTACTCATTGTTCTTGG - Intronic
988363130 5:30261944-30261966 TTGTTTGCATACATTTTTGTTGG + Intergenic
988384344 5:30540832-30540854 TTGTTTGTACCCATTCATGTTGG - Intergenic
989722945 5:44551956-44551978 TTGTTTGTACCCATATTTCTTGG + Intergenic
990272059 5:54152882-54152904 TTCATTGTACTGAATTTTGATGG + Intronic
990413222 5:55561716-55561738 GTCTTTGGACTCATTTTTTAAGG + Intergenic
990500598 5:56392946-56392968 TTGTTCATAATCATTTTTAATGG - Intergenic
990900097 5:60740165-60740187 TTGTTTGTACTCATCCTTTTTGG - Intergenic
990922265 5:60980173-60980195 TTGTTTGTACTCATCATTCTTGG - Intronic
991122976 5:63037216-63037238 TTCTCTGAACTCATTTTAGAAGG + Intergenic
992206560 5:74435904-74435926 TTATTTGGAATCATTTTAGAAGG + Intergenic
992562036 5:77962444-77962466 CTGTTTGGAATCATTTTTGGCGG - Intergenic
993674288 5:90798519-90798541 TTGTTTGGAATCATTTCAGAAGG - Intronic
993708128 5:91194674-91194696 TTATTTGTTCTCAGTTTTGGAGG - Intergenic
993824487 5:92665683-92665705 TTGTTTGAACTATTTCTTGAAGG - Intergenic
994531063 5:100971690-100971712 TTGTTTGTACCCATCTTTCTTGG - Intergenic
994712927 5:103287399-103287421 TTGTTAGTACAAATTTTTGATGG - Intergenic
994744356 5:103660517-103660539 CTGTTTGTACTCGTTTTTGTTGG + Intergenic
995418448 5:111935843-111935865 TGGTTTGTAGTCCTTTGTGATGG - Intronic
996813566 5:127547113-127547135 TTGTTTAAATTCATTTTTGAGGG + Intronic
996968415 5:129332414-129332436 CTGTTTGTACCCATTCTTCATGG - Intergenic
996968475 5:129333516-129333538 TTTGTTGTAGTTATTTTTGATGG - Intergenic
997609558 5:135206027-135206049 TTGTTTCTACTTTTTATTGAAGG - Intronic
997780574 5:136653812-136653834 CTGTTTGTAAACATTTTTAAAGG - Intergenic
998078256 5:139253792-139253814 TTTTATGTGCTTATTTTTGAGGG - Intronic
998882743 5:146660166-146660188 TTGTGTGTACCCATTATTGAAGG + Intronic
998907811 5:146925373-146925395 TATTTTGCCCTCATTTTTGAAGG + Intronic
999503017 5:152165589-152165611 ATGTCTGTTCTCATTTTTGCAGG - Intergenic
999592694 5:153166297-153166319 TTCTTTATTCACATTTTTGAAGG + Intergenic
999609744 5:153355935-153355957 TTGTTTATATTCATAATTGAAGG + Intergenic
999691822 5:154153168-154153190 TATTTTATATTCATTTTTGAAGG - Intronic
999940653 5:156539064-156539086 TTTTTTGTCCTGATTTTAGAAGG - Intronic
1000032059 5:157410727-157410749 GTGTTTGTAGTAATTTCTGAGGG - Intronic
1000213002 5:159126582-159126604 ATTTTTGTATTCACTTTTGAAGG + Intergenic
1000634634 5:163630069-163630091 TTGTTGGTCTTCTTTTTTGACGG + Intergenic
1002007619 5:176249150-176249172 TTGTTTGGAATCATTTCAGAAGG + Intronic
1002218760 5:177661475-177661497 TTGTTTGGAATCATTTCAGAAGG - Intergenic
1002572306 5:180148941-180148963 AACTTTGTACTCATTTTTGAAGG + Intronic
1002987325 6:2203114-2203136 TTACTTTTCCTCATTTTTGAAGG + Intronic
1003252686 6:4444993-4445015 TTGTTTGTATTCTTATTTAATGG + Intergenic
1003496392 6:6667390-6667412 TCTTTGGTACTCATTTTTGGGGG + Intergenic
1003510322 6:6774031-6774053 TTATTTGAAATCATTTTTGATGG + Intergenic
1003799494 6:9647483-9647505 TTGTCTGTACTGATGTTTGTTGG - Intronic
1003897489 6:10621596-10621618 ATGTTTAAACTTATTTTTGAAGG - Intronic
1004655108 6:17652165-17652187 TTGTTCTTATTCATTTTTCATGG - Intronic
1007536026 6:42589700-42589722 TTGTTTGTACTCATTTTTGAAGG + Intronic
1008250220 6:49231202-49231224 TTGTTTGTACCCGTTCTTCATGG + Intergenic
1008378474 6:50818124-50818146 TTGTTTGTATGCATTTTCAACGG - Intergenic
1009196950 6:60698061-60698083 TTATTTGTACGCATTGCTGAAGG - Intergenic
1009328994 6:62391666-62391688 TTGTATGTCTTTATTTTTGATGG + Intergenic
1009387988 6:63110622-63110644 TTGTTTGTACCCATCTTTCTTGG + Intergenic
1009652392 6:66492623-66492645 TTGTTTGGAATCATTTCAGAAGG - Intergenic
1009798600 6:68503480-68503502 TTGTTTCTTCTCATTTGTGTAGG - Intergenic
1010290998 6:74137764-74137786 TCTTTTGTAATTATTTTTGAAGG + Intergenic
1010537561 6:77049825-77049847 TTGTTTGGAGTAGTTTTTGAAGG + Intergenic
1010681470 6:78804141-78804163 TTGTTTGGAATCATTTCAGAAGG + Intergenic
1010748692 6:79593672-79593694 AGGTTTGTAGTCATTTTTCATGG + Intergenic
1011033421 6:82946579-82946601 TTCTGTGTACTTATTTTTGCTGG - Intronic
1011371212 6:86638680-86638702 TTGTGTGTACTCATTGCTGTGGG - Intergenic
1011716733 6:90113868-90113890 GTGTTTGTAATCGTTTCTGATGG - Intronic
1011798799 6:90986504-90986526 TTGGTTCTGCTGATTTTTGAAGG - Intergenic
1012392512 6:98758366-98758388 TTCTTTGAACACATTTTTGTAGG - Intergenic
1012631581 6:101476336-101476358 TTATTTTTATTCATTTTTGGAGG + Intronic
1012716771 6:102683813-102683835 TATTTTGTCTTCATTTTTGAAGG - Intergenic
1013385443 6:109625239-109625261 TTGTGTTAACTCATTTTTCAAGG + Intronic
1013647551 6:112160431-112160453 TTGTTTGTTTTGTTTTTTGACGG - Intronic
1014009104 6:116456890-116456912 TTGATTTTACTCTTTTTGGAGGG + Intergenic
1014446279 6:121531677-121531699 TTCTTTGTATTCATTTTTCAAGG - Intergenic
1014590354 6:123258684-123258706 TTGTTTGGAGTCATTTTAGAAGG + Intronic
1014640368 6:123901701-123901723 TTGTTTGTGGTCATATTTTATGG + Intronic
1014657873 6:124130693-124130715 TTGTTTGAATTAGTTTTTGACGG + Intronic
1014840653 6:126217355-126217377 TTGTTTGTACCCATTTTTCTTGG + Intergenic
1014957924 6:127643930-127643952 GTCTTTGTACTTATTTATGAGGG - Intergenic
1014993187 6:128107349-128107371 TTGTTTGTATACATTTTCTAAGG + Intronic
1015324423 6:131908338-131908360 TTGCTTTTCCTCATATTTGAGGG + Intergenic
1015462911 6:133513447-133513469 CTGTTTATATTTATTTTTGATGG - Intronic
1015587135 6:134787917-134787939 TTTTCTTTACTCTTTTTTGAGGG - Intergenic
1016134124 6:140517542-140517564 TTGTATGTACTCAGTTCTGTTGG - Intergenic
1016191462 6:141271789-141271811 TTATTTCACCTCATTTTTGAAGG + Intergenic
1016730492 6:147422850-147422872 TTTTTTGTACGCATGTTTGGTGG - Intergenic
1017532554 6:155310849-155310871 TTATTTTTATTTATTTTTGAAGG + Intronic
1017583560 6:155894856-155894878 TTGTTTTTTCTCAATTTTGCTGG - Intergenic
1018230636 6:161671846-161671868 CTGTTTGTTATCATTTTCGAGGG + Intronic
1018656083 6:166037560-166037582 TTGTTTGAGTTCATATTTGATGG + Intergenic
1018883427 6:167908445-167908467 GTGTTTGTACTTGTTTTTGTTGG + Intronic
1019044957 6:169138666-169138688 TTGTTTGTAACAATTCTTGAGGG + Intergenic
1020487337 7:8735685-8735707 TTGTTTGGAATCATTTCAGAAGG + Intronic
1020507571 7:9012783-9012805 TTATTTCTCTTCATTTTTGAAGG + Intergenic
1020525569 7:9254181-9254203 TTGTTTATAGTAATCTTTGATGG - Intergenic
1020572015 7:9875564-9875586 TTGTTTGTTGTCATTTGTTATGG - Intergenic
1020702615 7:11501978-11502000 TTGTTTGCAGTCATTTCTGATGG - Intronic
1020775396 7:12447986-12448008 TTGCTAGTATTCTTTTTTGAGGG - Intergenic
1021077422 7:16322148-16322170 TATTTTGTGTTCATTTTTGAGGG - Intronic
1022173938 7:27855806-27855828 TTGTTTGGAATCATTTCAGAAGG - Intronic
1022366824 7:29729805-29729827 TTGTTTGTACCCATCCTTGTTGG + Intergenic
1022389584 7:29931971-29931993 TTGTTTGTTTTAATTTTTGTGGG - Intronic
1022579482 7:31535766-31535788 TTGTTTGTTTTGATTTTAGAAGG + Intronic
1022741004 7:33121853-33121875 TTGTTTGTACCCATCTTTTTTGG + Intergenic
1022763934 7:33389122-33389144 TTACTTGTACTCATTTATGTGGG + Intronic
1023899746 7:44466585-44466607 TTGTTTCCCCTAATTTTTGAAGG - Intronic
1024170419 7:46779009-46779031 TTGTTTGTACTCATCCTTCTTGG - Intergenic
1024478483 7:49839405-49839427 TTGGTTGTCCTCAAATTTGATGG - Intronic
1024553780 7:50585280-50585302 TTGAAGGTACTCATTTTGGAGGG + Intergenic
1024883249 7:54113328-54113350 TTGTCTGTCATCATTTTCGATGG + Intergenic
1025637402 7:63335081-63335103 TTGTTTTTACACATTTTGGAGGG + Intergenic
1025645295 7:63413018-63413040 TTGTTTTTACACATTTTGGAGGG - Intergenic
1025715828 7:63954145-63954167 TTGTTTTTACACATTTTGGAGGG - Intergenic
1026480871 7:70778267-70778289 TTGTTTGCTCCCATTTTTGCAGG - Intronic
1027481263 7:78699814-78699836 TTCTTGGTACTCACTTTTTATGG - Intronic
1027605035 7:80289014-80289036 TTGTTTGTACCCATTCTTCTTGG - Intergenic
1027755493 7:82205598-82205620 TGGATTGTAACCATTTTTGACGG - Intronic
1028266059 7:88727261-88727283 TTGTTTGTACTCATATATTCTGG + Intergenic
1028441385 7:90866417-90866439 TTCATTGTACCCTTTTTTGAGGG + Intronic
1028894062 7:96021222-96021244 TTGTTTGTTTGCATATTTGAGGG - Intronic
1029412033 7:100419497-100419519 AGGTTTGTATTCCTTTTTGAGGG - Intronic
1029825446 7:103187654-103187676 TTGTTTGTACCCATCCTTGTTGG - Intergenic
1029842435 7:103380263-103380285 TTATTTTTCCTCATTTTTAATGG - Intronic
1030175255 7:106646303-106646325 TTCTTAATACTGATTTTTGAGGG - Intergenic
1030380578 7:108806401-108806423 ATTTTTGTAGTCATTTATGAAGG - Intergenic
1030437518 7:109542717-109542739 TTTATTGTTTTCATTTTTGATGG + Intergenic
1030748323 7:113196856-113196878 TTGTTTAAACACATTTTTAAAGG + Intergenic
1030921584 7:115396313-115396335 TTTTTCATACTCTTTTTTGAAGG + Intergenic
1030958980 7:115890924-115890946 TTGTTTGTAATAATTTCAGAAGG - Intergenic
1031173921 7:118325105-118325127 TTTTTTGTACTCATGTTTGGTGG + Intergenic
1031275930 7:119723807-119723829 TTATTTGTATTCTTTTTTGAAGG - Intergenic
1031585792 7:123531288-123531310 TGGTTGGTAATCATTTTTTATGG - Intronic
1031602966 7:123735023-123735045 TTGTTTATATTTATATTTGAAGG - Intronic
1031637050 7:124114262-124114284 TTGTCTTTTCTCATTTTTCATGG - Intergenic
1031749423 7:125553337-125553359 TCTTTTGTATTCAATTTTGAAGG + Intergenic
1032620488 7:133525812-133525834 TTGTCTGTAATCATAGTTGAAGG + Intronic
1033480073 7:141730859-141730881 TTTTCTGTACACATTTTTAAAGG + Exonic
1033877174 7:145836452-145836474 TTTTTTGTACTCATTTTTTGAGG + Intergenic
1033971410 7:147045240-147045262 TAGTGTGAACTCATTTTTGTGGG - Intronic
1035043901 7:155951717-155951739 TTATTTGTTTTCATGTTTGAGGG + Intergenic
1036533064 8:9614967-9614989 CTGTTTCTAAACATTTTTGATGG + Intronic
1036544308 8:9751587-9751609 TTGTTTTTAATCATTTTTTTAGG + Exonic
1038121665 8:24623748-24623770 TTTTTTATAGTCATTCTTGAGGG - Intergenic
1038944266 8:32339884-32339906 TTGTTTCTACTTTTTTTTAATGG + Intronic
1039007462 8:33055951-33055973 TGGTTTCTACTCATTTTTTCTGG + Intergenic
1039658511 8:39436617-39436639 TTGTTTGGAATCATTTCTGAAGG - Intergenic
1040096824 8:43453515-43453537 TTATTTTTACTCATATTTTAGGG - Intergenic
1040436453 8:47396124-47396146 GTATTTGTACTTATTTTTGTGGG + Intronic
1040556355 8:48481154-48481176 TTGTTTTTTCACTTTTTTGATGG + Intergenic
1040634516 8:49256496-49256518 TTGTTTTCACTCAGTTTTGGGGG + Intergenic
1040969744 8:53122262-53122284 CTTTTTGTATTTATTTTTGAAGG + Intergenic
1041021063 8:53639267-53639289 TTGTTTGGAATCATTTCTGAAGG + Intergenic
1041287794 8:56278543-56278565 TTGTTTGGATTCATTTCAGAAGG - Intergenic
1043130680 8:76457190-76457212 ATGTTTATATTCATTTTTGTAGG - Intergenic
1043468517 8:80538408-80538430 TTATTTGTATTTATTTTTGTGGG + Intergenic
1044057221 8:87586066-87586088 TTGTTTGTACCCATCCTTGGTGG - Intronic
1045159625 8:99523758-99523780 TTGTTTGTACCCATTTTTCTAGG - Intronic
1045802855 8:106121968-106121990 TTGTTTGTACTCTATTTTCCTGG - Intergenic
1045805252 8:106152057-106152079 CTGTTTTTTCTCATTTTTGCTGG - Intergenic
1045859556 8:106800361-106800383 TTGTATGTAGGCATTTTTAATGG + Intergenic
1046317984 8:112531594-112531616 TTCTATGTACTTATTTCTGATGG - Intronic
1046705717 8:117449314-117449336 TTCTTTTTTGTCATTTTTGAAGG + Intergenic
1046811439 8:118537917-118537939 TTGTTTGTACTCATCTTTCTTGG + Intronic
1047456336 8:125016728-125016750 TTGTTTGTACCCATCTTTCTTGG + Intronic
1047769519 8:128019584-128019606 TTTTTTGTACTTTGTTTTGAGGG + Intergenic
1048666912 8:136672705-136672727 TAGTTTGTTCTCATTATTCATGG - Intergenic
1050146295 9:2571559-2571581 GTGTTTGTATTCATTTTCTAGGG + Intergenic
1050207913 9:3217272-3217294 TTTTTTGTTTTTATTTTTGATGG + Intergenic
1050238699 9:3612091-3612113 TTGTTTGTACTCATTCTTCTTGG + Intergenic
1050675180 9:8044158-8044180 TTGATTGGAATCATTTCTGAAGG + Intergenic
1050718801 9:8561467-8561489 TAGTTTGTACTCACATTTGGGGG - Intronic
1050813918 9:9785119-9785141 TTGTTTCTGCTCAATATTGATGG + Intronic
1051546855 9:18285682-18285704 TTGTTTATAATCATTTTGAATGG + Intergenic
1051806148 9:20994723-20994745 GAGTTTGTGCTCATTTTTAATGG + Intronic
1052114705 9:24636256-24636278 TGGTTTGTAGTTCTTTTTGAAGG + Intergenic
1052380573 9:27766653-27766675 TATTTTGTACTCTTTCTTGATGG + Intergenic
1052481902 9:29040412-29040434 TGGATTGTACTCAGTTTTAAAGG - Intergenic
1052551114 9:29950635-29950657 TTGTTTCTTTTCATTTTTGGTGG + Intergenic
1052702682 9:31957590-31957612 TTGTTTGTTCTCATTTGTTTTGG - Intergenic
1052876517 9:33571227-33571249 TTTTTTTTACTTATTTTAGATGG + Intronic
1053661717 9:40288004-40288026 TTATTTTTACTTATTTTAGATGG + Exonic
1053912089 9:42917348-42917370 TTATTTTTACTTATTTTAGATGG + Intergenic
1054373841 9:64434240-64434262 TTATTTTTACTTATTTTAGATGG + Intergenic
1054522891 9:66088280-66088302 TTATTTTTACTTATTTTAGATGG - Intergenic
1055082984 9:72285559-72285581 TTGTCTTTTCACATTTTTGATGG + Intergenic
1056026590 9:82503655-82503677 ATGTTCCTACACATTTTTGATGG + Intergenic
1056485126 9:87048717-87048739 TTGTTTTTTCACATTCTTGATGG - Intergenic
1057493060 9:95537706-95537728 TGGTTGGTGCTCATTTTTAAAGG - Intergenic
1058062069 9:100508356-100508378 TTATTTCTACTCATCTTTCAGGG + Intronic
1058179626 9:101780783-101780805 ATGTTTGGAGACATTTTTGATGG + Intergenic
1058229108 9:102404301-102404323 TGGTTTTTACTCATTTTTGCTGG - Intergenic
1058383570 9:104406977-104406999 TTTTTTATAGTCATTTTTAATGG + Intergenic
1059230991 9:112721475-112721497 TTGTTTGTAGTTGTTTTTGTTGG + Intergenic
1059634576 9:116158254-116158276 ATGTGGGTACTCTTTTTTGAGGG - Intronic
1059695671 9:116728152-116728174 TTGTTGGTGCTCATGTATGATGG - Intronic
1060385226 9:123219962-123219984 TTGTTTGCATTCATTCCTGAAGG - Intronic
1061839162 9:133347772-133347794 TTGTTTGTGCCCATTTTTGGCGG + Intronic
1203532453 Un_GL000213v1:159198-159220 TTGTTTGTAATAGTTTCTGAAGG + Intergenic
1203707360 Un_KI270742v1:64896-64918 TTATTTTTACTTATTTTAGATGG + Intergenic
1185998576 X:4981851-4981873 TTATTTTTGCTCATTTTTCAGGG + Intergenic
1186919673 X:14264270-14264292 TTGTTTGGAATCATTTCAGAAGG + Intergenic
1187628141 X:21139929-21139951 TTGTTTGAAATCATTTCAGAAGG - Intergenic
1187700224 X:21957791-21957813 TTAATTGTAGTCATTTTTGCAGG + Intronic
1188212657 X:27443312-27443334 TTGTTTTTTTTCCTTTTTGAAGG - Intergenic
1188641960 X:32516741-32516763 TTGTTTGCTGTGATTTTTGAGGG - Intronic
1188652474 X:32649131-32649153 TTGAGTGTACTCAATTTTGGGGG - Intronic
1188729220 X:33625812-33625834 TTGTGTTTACTCATTTAGGAAGG - Intergenic
1188854773 X:35180320-35180342 TAGTTTGTAGTGAGTTTTGAGGG - Intergenic
1188962054 X:36504101-36504123 TTGTTTTTACTAATTCTTTAGGG + Intergenic
1189434771 X:40982051-40982073 TTTTATGTAATCATTCTTGATGG - Intergenic
1189905156 X:45751402-45751424 TTGTTTTTACTTATCATTGATGG - Intergenic
1190893746 X:54596191-54596213 TTGTTTGTACCCATCTTTCTTGG + Intergenic
1191593104 X:62911317-62911339 TTGTTTGTACCCGTTTTTGGGGG + Intergenic
1191687446 X:63906614-63906636 TTGTTTGGAATCATTTCAGAAGG - Intergenic
1191711952 X:64159220-64159242 TTTTTTTTACTAATTTTTTAAGG + Intergenic
1191781695 X:64874998-64875020 TTGTTTGTACCCATTCTTCTTGG - Intergenic
1191966421 X:66763632-66763654 TTGTTTGGAATCATTTCAGAAGG + Intergenic
1191986244 X:66984638-66984660 TTACTTGTACTCATTTTTCTTGG + Intergenic
1192020233 X:67382592-67382614 TTGTTTTAACACATTTTTGTAGG - Intergenic
1192083310 X:68069260-68069282 TTTTTTGCACTCATTTATTAAGG + Intronic
1192927234 X:75767745-75767767 TTGTTTGTACCCATTCTTCTTGG - Intergenic
1193185188 X:78502939-78502961 TTGTTTGTACCCATTCTTCTTGG - Intergenic
1193191001 X:78571641-78571663 TTGTTTGTACTCATTCTTCTTGG + Intergenic
1193233328 X:79075158-79075180 TTGTTTGGAATAATTTCTGAAGG - Intergenic
1193426683 X:81348423-81348445 TTAATTGTTCTCATTTTTGGTGG + Intergenic
1193528840 X:82628079-82628101 TTGTTTGTACTTGTTTTTCTTGG - Intergenic
1193685775 X:84575131-84575153 TTGTTTGGAATCATTTCAGAAGG - Intergenic
1193932620 X:87574379-87574401 TTGTTTTTAATTATTTTTCAGGG + Intronic
1194056060 X:89133641-89133663 TTTTTTTTAATCATATTTGAAGG + Intergenic
1194175308 X:90639086-90639108 TTGTTTTCTCTCATTTTTGTTGG + Intergenic
1194235777 X:91381587-91381609 TTGTTTGTACCCATTCTTCTTGG - Intergenic
1194251948 X:91586913-91586935 ATGTTTTTACTTATTTGTGAAGG + Intergenic
1194253319 X:91604095-91604117 TTGTTTGTACTCATTCTTCTTGG - Intergenic
1194360920 X:92949736-92949758 TTGTTTGTACTCATCCTTCTTGG + Intergenic
1194912383 X:99662668-99662690 GTGTTTGTATTTATTTTTTATGG + Intergenic
1194951078 X:100126861-100126883 TTGCTTTTACTCATTTATGATGG - Intergenic
1195849012 X:109263433-109263455 TTATTTGTACTCATTCTTCTTGG + Intergenic
1195873221 X:109508646-109508668 TTATTTCTCCTTATTTTTGAAGG - Intergenic
1196154225 X:112408932-112408954 TTATTTCTCTTCATTTTTGAAGG - Intergenic
1196248573 X:113429669-113429691 TTGTTTGTACCCATCTTTCTTGG - Intergenic
1197030417 X:121807041-121807063 TTTGTTGTAGTTATTTTTGATGG + Intergenic
1197069510 X:122279209-122279231 TTGGTTGTAGTTATTTTTTATGG + Intergenic
1197282767 X:124556409-124556431 TTGTTTGTTGTCTTTTTGGAGGG + Intronic
1197644281 X:129001216-129001238 TTCTTTGTAAGCATTTTTAAGGG - Intergenic
1197670489 X:129272443-129272465 TTGTTTGTACCCATTCTTCTTGG + Intergenic
1197963917 X:132035784-132035806 TTGTTTGTTTTTTTTTTTGAGGG - Intergenic
1198442180 X:136673869-136673891 TTGTATTTATTTATTTTTGATGG + Intronic
1198698913 X:139375248-139375270 TTGTTTGTAATAATTTTAGAAGG + Intergenic
1200405290 Y:2804292-2804314 TTGTTTGGAATAATTTCTGAAGG + Intergenic
1200423045 Y:2992676-2992698 TATTTTTTACTCATTTTTGAAGG + Intergenic
1200570880 Y:4828151-4828173 ATGTTTTTACTTATTTGTGAAGG + Intergenic
1200669120 Y:6065548-6065570 TTGTTTGTACTCATCCTTCTTGG + Intergenic
1201054115 Y:9971408-9971430 TTGTTTGAATGCATTTTTCAAGG - Intergenic
1201483027 Y:14460958-14460980 TTGTTTGGAATCATTTCAGAAGG - Intergenic
1201497905 Y:14609278-14609300 TTGTTTGTGCTGATTTTCCAAGG + Intronic
1201703029 Y:16904986-16905008 GTGTTTGTAGTAATCTTTGATGG - Intergenic
1202240006 Y:22757098-22757120 TTGTTGGTATGCATTTTTCAAGG + Intergenic
1202300009 Y:23402940-23402962 ATGTTTAAGCTCATTTTTGAGGG + Intergenic
1202305366 Y:23464031-23464053 TTGTTTTTTATCATTTTTAATGG + Intergenic
1202392992 Y:24390860-24390882 TTGTTGGTATGCATTTTTCAAGG + Intergenic
1202477793 Y:25279257-25279279 TTGTTGGTATGCATTTTTCAAGG - Intergenic
1202565443 Y:26206558-26206580 TTGTTTTTTATCATTTTTAATGG - Intergenic
1202570801 Y:26267658-26267680 ATGTTTAAGCTCATTTTTGAGGG - Intergenic