ID: 1007537632

View in Genome Browser
Species Human (GRCh38)
Location 6:42608078-42608100
Sequence GTGACAAATACTCCCGTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007537630_1007537632 16 Left 1007537630 6:42608039-42608061 CCTGTTGATAGACAATTAGGATG 0: 1
1: 0
2: 14
3: 201
4: 645
Right 1007537632 6:42608078-42608100 GTGACAAATACTCCCGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007537632 Original CRISPR GTGACAAATACTCCCGTTAT GGG Intronic