ID: 1007538462

View in Genome Browser
Species Human (GRCh38)
Location 6:42618357-42618379
Sequence TCAAGGATCTTCAAGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007538462_1007538465 -1 Left 1007538462 6:42618357-42618379 CCAGGACACTTGAAGATCCTTGA 0: 1
1: 0
2: 3
3: 10
4: 120
Right 1007538465 6:42618379-42618401 AACCTGGAGTGAAATTGTATAGG 0: 1
1: 0
2: 0
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007538462 Original CRISPR TCAAGGATCTTCAAGTGTCC TGG (reversed) Intronic
900324484 1:2101609-2101631 GCAAAGGTCTTCAAGTGCCCTGG + Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
905522592 1:38612018-38612040 ACACGGATCTTCAAGATTCCAGG + Intergenic
910477755 1:87624777-87624799 GCAAAGGTCTTCAAGTGTCTGGG + Intergenic
911441119 1:97926846-97926868 TCAAGGATCTTACAGTGTAGGGG - Intergenic
915432942 1:155880695-155880717 GCAAGGATCTTGAAGTGTGGAGG - Intronic
919208786 1:194453203-194453225 TCAAGCATCTTCCAATGTCTGGG - Intergenic
923457409 1:234176380-234176402 TCAAAGATCTTCCTTTGTCCAGG - Intronic
1065285896 10:24187510-24187532 TGATGAATCTTCAAGTGTACTGG - Intronic
1066149873 10:32605236-32605258 TCGTGGTTCTTCAGGTGTCCAGG - Intronic
1066235788 10:33482993-33483015 TGAATGATCTTCTAGTGCCCAGG + Intergenic
1067544443 10:47182982-47183004 GCATGGATCTTCAAGTGTCTGGG + Intergenic
1072047727 10:91673350-91673372 TCAAGGATCCCTAATTGTCCAGG - Intergenic
1085076081 11:73593938-73593960 TCAAGGAGCTTTCAGTGTCATGG - Intronic
1085664279 11:78399547-78399569 TCAAGGATCTGCCAGTCTCATGG - Intronic
1087094502 11:94306450-94306472 GCAAGGATCGGCAAGTGTCTAGG - Intronic
1088095576 11:106096825-106096847 TGAAGGATCTTCAGGTGTCATGG - Exonic
1094019535 12:25899586-25899608 TCAAGGATCTGGAGATGTCCAGG - Intergenic
1095044817 12:37490318-37490340 GCAAGCATCTTTAAGTATCCAGG - Intergenic
1098477304 12:70920469-70920491 CCAAGGGTCTTCTAGTCTCCGGG + Exonic
1107737436 13:43415005-43415027 TAAAGGGGCATCAAGTGTCCTGG + Intronic
1108059562 13:46519126-46519148 CCAAGGCTCTACAAGTCTCCAGG + Intergenic
1108116322 13:47132529-47132551 TCTGGGATCTTCAAGTTCCCTGG - Intergenic
1110685096 13:78363111-78363133 TCACATATCTTCAAATGTCCAGG - Intergenic
1111211146 13:85082047-85082069 GGAAGGAGTTTCAAGTGTCCGGG - Intergenic
1116258337 14:42586949-42586971 TCACTGATCTTCAAGTGTGTAGG + Intergenic
1118593698 14:67420054-67420076 TCAGGGATTTTCCAGGGTCCTGG - Intergenic
1118764481 14:68900692-68900714 TCTGGCATCTTCAAGTGTCCTGG + Intronic
1119757300 14:77128130-77128152 TAAAGGATCCGCAAGTCTCCAGG - Intronic
1119989939 14:79185296-79185318 TCATGAATCTGCAAGTGTCCAGG - Intronic
1120080000 14:80205393-80205415 TCAAGAACCTACAAGTGTACAGG - Intronic
1121952919 14:98187633-98187655 TCCAGGATCCTCAGCTGTCCAGG - Intergenic
1122167423 14:99838834-99838856 TCAACAATCTTCAAGTGCCCAGG + Intronic
1124658709 15:31528099-31528121 TTTAGGAACTTCATGTGTCCCGG - Intronic
1133827993 16:9296012-9296034 TCAAGTAACTTCAAGTGTCCAGG + Intergenic
1141205846 16:81932649-81932671 TCAAGGATCCTCTCGTGACCAGG - Intronic
1148195199 17:45708172-45708194 ACAAGGATCTTTATGTGCCCAGG - Intergenic
1151163096 17:72182566-72182588 AGAAGGATCTTCAACTCTCCTGG + Intergenic
1151714623 17:75825122-75825144 TCAAGGAGCTTCAAGGGCCCAGG - Exonic
1153344309 18:4009552-4009574 TCAATGAACTTAAAGTCTCCTGG + Intronic
1155473453 18:26214506-26214528 TTAAGGAACTTAAAGTGTTCTGG + Intergenic
1157752040 18:50187820-50187842 CCAATGTTCTTCAAGTGTCAAGG + Intronic
1157837540 18:50920190-50920212 TAAACTATTTTCAAGTGTCCAGG - Intronic
1158007067 18:52684775-52684797 TAAAGGATCTTCAAGTGTACAGG + Intronic
1159637260 18:70820624-70820646 AAAAGTATCTTCAAGTCTCCTGG + Intergenic
1160900703 19:1426641-1426663 TCAAGAACCTCCAAGGGTCCAGG - Intronic
1164176240 19:22777745-22777767 TCAAGTGTCTACAAGTCTCCTGG - Intronic
1168550499 19:57289549-57289571 TCAAGGAGCTACAAGAGGCCAGG - Intronic
1168661298 19:58169139-58169161 TCACTTATCTTCTAGTGTCCAGG - Intergenic
928630540 2:33187144-33187166 TCAAGGATCTGCGGGTGGCCAGG + Intronic
930691077 2:54365288-54365310 ACAGGGTTCTTCAAGTTTCCTGG - Intronic
931342438 2:61414552-61414574 TCTTGGATCTCCAAGTTTCCTGG - Intronic
932774602 2:74520222-74520244 TCAAGGAGCTTCAAGTCTGGTGG + Intronic
935119767 2:100174335-100174357 TCAAGGACATTCTTGTGTCCAGG + Intergenic
935703495 2:105835635-105835657 TTAAGGATCTTAGAGTTTCCTGG + Intronic
944047524 2:195429944-195429966 TCAAGGAGCTTCCAGGGACCAGG - Intergenic
945364288 2:208931727-208931749 ACAAGCATCCTGAAGTGTCCAGG - Intergenic
947143244 2:227039604-227039626 GCAAGGATTTTTAAGTGTCTTGG - Intronic
948754435 2:240150775-240150797 TTCAGGATCTTGGAGTGTCCTGG + Intergenic
1169512733 20:6282649-6282671 TAAATGATGTTCAAGTTTCCAGG + Intergenic
1171539360 20:25933942-25933964 GCAAGCATCTTTAAGTATCCAGG - Intergenic
1171801677 20:29626342-29626364 GCAAGCATCTTTAAGTATCCAGG + Intergenic
1171956377 20:31466936-31466958 TCAAGGAGCTTCCAGCGTCAAGG + Intronic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1175124471 20:56741098-56741120 TCAAGGATCTCCAAGTGGGGAGG - Intergenic
1175132342 20:56798757-56798779 TCCAGGATCTCCAAGTGGACAGG + Intergenic
1180063923 21:45403517-45403539 TCAGGGGTGTTCATGTGTCCTGG - Intergenic
1184603324 22:45556721-45556743 AGGAGGAGCTTCAAGTGTCCAGG + Intronic
949332268 3:2935621-2935643 TCAAGGTTCTACATGTGTCACGG + Intronic
949803803 3:7932798-7932820 TCAAAGATCATCAACTGGCCGGG - Intergenic
951050784 3:18090373-18090395 TCAAGGACCTTCAAGTTCCCAGG - Intronic
952022221 3:29037239-29037261 TGAAGGATTTTCAAGTTTCTAGG - Intergenic
952149738 3:30575994-30576016 TCACAGATTTTCAACTGTCCTGG + Intergenic
956775115 3:72558568-72558590 TCATGGCTCTTCAACTGTACAGG - Intergenic
957216217 3:77323243-77323265 TCAAGGATTTCCAACTGCCCAGG + Intronic
959147019 3:102559374-102559396 TCCAGGTTCTTCCTGTGTCCAGG + Intergenic
959434840 3:106301860-106301882 ACAAGGATCCTAAAGTCTCCTGG - Intergenic
960366518 3:116779267-116779289 TCAGGGATTTTCAATTGTCTTGG - Intronic
965450737 3:168834607-168834629 TCATGAATCTTCCAGTTTCCAGG + Intergenic
967681598 3:192370148-192370170 TTAAAGATCCTCAAGTGTCCTGG - Intronic
970986535 4:22165739-22165761 TGAAAGATCTTCAAATGCCCAGG + Intergenic
972944760 4:44240702-44240724 TCAAGTATCTTCAGGAGTACAGG + Intronic
973048451 4:45566148-45566170 TCATGGATCTACAAGTGTCCAGG - Intergenic
974659769 4:64872222-64872244 TCAAGTCTCTTTATGTGTCCTGG + Intergenic
977108047 4:92915394-92915416 TCAAGGATGGTCAAATGTTCTGG + Intronic
985076434 4:186219992-186220014 AAAAGGATCTCAAAGTGTCCAGG + Intronic
988360765 5:30233583-30233605 TGAAGGATCTTTGTGTGTCCTGG + Intergenic
992425139 5:76649290-76649312 TCCAGGTTCTACAAGTGTCTGGG - Intronic
999761166 5:154702258-154702280 CTAAGTATCTTCAAGTGGCCAGG + Intergenic
999884906 5:155911528-155911550 TCAAGTCTCTTCCAGAGTCCTGG + Intronic
1001164949 5:169356085-169356107 TCAAGGAGTTTCAAGTGTAATGG + Intergenic
1003838385 6:10094913-10094935 TCAAGAAAATGCAAGTGTCCTGG + Intronic
1005241021 6:23826825-23826847 TCAAGGATCTTTAAATGACAGGG + Intergenic
1007538462 6:42618357-42618379 TCAAGGATCTTCAAGTGTCCTGG - Intronic
1010906252 6:81493685-81493707 TAAAGGATCCTCACGTGTCCTGG - Intronic
1011934763 6:92762363-92762385 TCAAGACTTTTCAAGTCTCCTGG + Intergenic
1013731336 6:113171598-113171620 TCAGGGACCTACAAGTGTTCAGG + Intergenic
1016876714 6:148872898-148872920 TCTAGGATCTTCCAGCATCCTGG + Intronic
1016961703 6:149678883-149678905 TCAAGGATCATAAAGTGTTTAGG + Intronic
1020694273 7:11394616-11394638 TCAAGGAACATCACGTGTGCGGG - Intronic
1021094947 7:16525912-16525934 TTAAGGCTCCTCAAGAGTCCAGG - Intronic
1022390078 7:29936074-29936096 TGAAGCAACTTCAAGTGTACTGG - Intronic
1024292991 7:47819172-47819194 GCAGGGATATTCAAGTATCCTGG - Intronic
1024913181 7:54469456-54469478 ATAAGCATCCTCAAGTGTCCTGG + Intergenic
1025290744 7:57719866-57719888 GCAAGCATCTTTAAGTATCCAGG - Intergenic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026593102 7:71713012-71713034 AAAAGCATCTTCAAGGGTCCTGG - Exonic
1029919949 7:104252461-104252483 ACAAGGAGCTTGAAGTGCCCAGG - Intergenic
1032023881 7:128426110-128426132 ACAATGGTCTTCAAGTGTCTTGG + Intergenic
1033615010 7:143005502-143005524 ACAAGGATCTTCCAGTGCCTGGG + Intergenic
1034283730 7:149870975-149870997 CCTAGGGCCTTCAAGTGTCCTGG + Intergenic
1034955303 7:155330075-155330097 TGAAGGATCTTCAGGTGGCGGGG + Intergenic
1035347307 7:158211048-158211070 TCAACAATCGTCAACTGTCCTGG + Intronic
1038214521 8:25549643-25549665 TCAAGGCTCTGCAAGACTCCAGG + Intergenic
1038548325 8:28443406-28443428 TGAGGAATCTTCAAGTGTTCAGG + Intronic
1039758037 8:40543892-40543914 TCATGGACTTCCAAGTGTCCAGG + Intronic
1044525780 8:93249956-93249978 TCAAGGAGCTTAAAGTGTAGTGG + Intergenic
1046438528 8:114227924-114227946 TCAAGAATGTGCAAGTGTTCTGG + Intergenic
1046578620 8:116063866-116063888 TCAAGTATCTTTAAGTTTTCTGG - Intergenic
1049596867 8:143488818-143488840 TCATGGAACTCCAAGTGTTCAGG - Intronic
1050952082 9:11610285-11610307 TACAGGATCTCCATGTGTCCTGG + Intergenic
1051519652 9:17971732-17971754 ACAGGCATCTTCAAGTGTACAGG - Intergenic
1051564208 9:18478575-18478597 TCATGTATCTTCCAGTTTCCAGG + Intronic
1054165699 9:61725508-61725530 GCAAGCATCTTTAAGTATCCAGG + Intergenic
1057191933 9:93093287-93093309 TCAAGGGTGATCAAGTATCCAGG - Intergenic
1190596723 X:52059493-52059515 TCCAGGGTCTTGCAGTGTCCTGG - Intergenic
1190612101 X:52194580-52194602 TCCAGGGTCTTGCAGTGTCCTGG + Intergenic
1190616486 X:52239219-52239241 ACAAGGAACTTCAAATGCCCAGG - Intergenic
1194620771 X:96168382-96168404 TCAATTATCTTCAAGTGTTGTGG + Intergenic
1199660703 X:150047449-150047471 TCAAGGGTCTTCTAGGGTTCAGG - Intergenic