ID: 1007544727

View in Genome Browser
Species Human (GRCh38)
Location 6:42684900-42684922
Sequence GAGAGGTGTTTCCAGTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007544727_1007544732 18 Left 1007544727 6:42684900-42684922 CCCTGCCACTGGAAACACCTCTC 0: 1
1: 0
2: 0
3: 20
4: 182
Right 1007544732 6:42684941-42684963 TTTTGTTGTTGTTCTTTGTTTGG 0: 1
1: 20
2: 117
3: 754
4: 3518
1007544727_1007544731 -6 Left 1007544727 6:42684900-42684922 CCCTGCCACTGGAAACACCTCTC 0: 1
1: 0
2: 0
3: 20
4: 182
Right 1007544731 6:42684917-42684939 CCTCTCTACAAAGAATTTGAAGG 0: 1
1: 0
2: 0
3: 22
4: 508
1007544727_1007544733 19 Left 1007544727 6:42684900-42684922 CCCTGCCACTGGAAACACCTCTC 0: 1
1: 0
2: 0
3: 20
4: 182
Right 1007544733 6:42684942-42684964 TTTGTTGTTGTTCTTTGTTTGGG 0: 1
1: 14
2: 99
3: 587
4: 3799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007544727 Original CRISPR GAGAGGTGTTTCCAGTGGCA GGG (reversed) Intronic
901208614 1:7511750-7511772 GCCAGGTGTTTCCCGTGGCTGGG + Intronic
901861355 1:12076688-12076710 GAGAGGTGCTGCCTGTGGCCAGG + Intronic
901971337 1:12911510-12911532 GAGAGGTGCAGCCAGGGGCAAGG - Intronic
902013830 1:13290230-13290252 GAGAGGTGCAGCCAGGGGCAAGG + Intergenic
902306928 1:15547934-15547956 GGAAGGTGTTATCAGTGGCATGG + Intronic
902948097 1:19858184-19858206 GAGAGGTGTGAGCAGTGCCAGGG - Intergenic
903704134 1:25272597-25272619 GAGAGCTGCTTCCAGTGTTAGGG - Exonic
903723104 1:25420715-25420737 GAGAGCTGCTTCCAGTGTTAGGG + Exonic
904206217 1:28856925-28856947 GAGAGGTGAGTCCAGTTGCATGG + Intronic
905929833 1:41779228-41779250 GAGAGGTGTCTGCAGTGGAGTGG + Intronic
912471881 1:109911824-109911846 CAGAGCTGTGTCCAGGGGCAGGG + Intronic
913316254 1:117555551-117555573 GAGAGGAGTTTTCAGTGGATAGG + Intergenic
915346636 1:155200859-155200881 GAGAGGAGCTTCAAGGGGCAGGG + Intronic
915924313 1:160004477-160004499 GAGAGGTGTGTGCAGGGGCAGGG - Intergenic
917534850 1:175866992-175867014 GAGCGGTGTTTCCAAAAGCATGG + Intergenic
917632809 1:176906502-176906524 AAGAGGTGTTATTAGTGGCATGG + Intronic
918399732 1:184151659-184151681 GCAAGGTGTTTTCAGTGACAGGG + Intergenic
919257101 1:195139332-195139354 GAGAAGTTTTTCCTGTGGGAAGG - Intergenic
919946459 1:202322694-202322716 GAGAGGAGTGATCAGTGGCAAGG + Intergenic
920031666 1:203041144-203041166 CAGAGGTTTTTCCAGGGGGAGGG + Intronic
920339696 1:205268076-205268098 GAGAGGTGTCAGCAGAGGCAGGG + Intronic
921046410 1:211481054-211481076 GAAAGGTGGCTGCAGTGGCAGGG - Intronic
923094431 1:230763414-230763436 GAGTGGTGTTGCCAGGGGCTGGG - Intronic
1064016627 10:11778119-11778141 GACAGGTGTTTCCAGATGAAAGG + Intergenic
1067919386 10:50437929-50437951 GAGAGTTGCTTCCAAAGGCAGGG + Intronic
1069582880 10:69577368-69577390 GACAGGTGTGTCCAGGGGCCAGG - Intergenic
1072709620 10:97707537-97707559 GACAGTTGTTTGCAGCGGCAGGG - Intergenic
1072989134 10:100173653-100173675 GAAAGGTATTTCAAGTGGGAGGG - Intronic
1073732334 10:106304439-106304461 GTGAGATCTTTCCAGTGTCATGG - Intergenic
1074961992 10:118455302-118455324 GACAAGTGTGTCCAGTGGGACGG - Intergenic
1075742986 10:124706974-124706996 GAGAGGTGGTTCCAGTCCCCTGG - Intronic
1076804355 10:132847649-132847671 GAGAGGTGTTTCCAAAGGACAGG - Intronic
1077724243 11:4657996-4658018 GAAAAGTGATCCCAGTGGCACGG + Intergenic
1078096697 11:8301801-8301823 GAAAGGTGTTTCCAAAGGAAAGG - Intergenic
1085782055 11:79418618-79418640 GAGAGGACATTCCAGTTGCAGGG - Intronic
1087106336 11:94412017-94412039 GAGAGTTATTTCCATTGTCAAGG + Intergenic
1090528486 11:127563259-127563281 GCTAGTTGTTTCCTGTGGCAAGG + Intergenic
1091743587 12:2976890-2976912 GGGAGGAGTCTCCAGTGGGAGGG - Intronic
1092066755 12:5596702-5596724 TAGATGTGTATTCAGTGGCATGG + Intronic
1092776010 12:11945821-11945843 GTGAGGGGGTTCCAGGGGCATGG + Intergenic
1096549817 12:52364639-52364661 GAGAGCTGGTTCCATTGGCAGGG + Intronic
1096829046 12:54300536-54300558 GAGAGGGGTCTCCAGAGGCAAGG - Intronic
1097709869 12:62906375-62906397 GTGTGCTGTTTCCAGTGTCAGGG + Intronic
1102636339 12:114327585-114327607 TAGTGGTATATCCAGTGGCAAGG + Intergenic
1102779829 12:115554506-115554528 GATAGGTGTTTCTAGTGGAGAGG + Intergenic
1104950809 12:132439057-132439079 GACAGATGTTCCCAGAGGCATGG - Intergenic
1105698526 13:22915505-22915527 GTGAGGTGTTGGCAGTGGAAAGG + Intergenic
1107067034 13:36225498-36225520 GAATGGTGTTTCCAGGGGCCAGG - Intronic
1107676254 13:42800492-42800514 GAGTCGTGATTCCTGTGGCATGG + Intergenic
1110307644 13:74008356-74008378 CAGATGTGTTTCCAGTTGCTTGG - Intronic
1110846575 13:80196781-80196803 GGGAGGTGGTCCCAGGGGCAGGG - Intergenic
1112779199 13:102879573-102879595 CAGGGATCTTTCCAGTGGCATGG + Intergenic
1115336542 14:32248298-32248320 GAGGGGTGTGTCCTGTGGTATGG + Intergenic
1116699477 14:48221288-48221310 GTGAGAAGTTTCCAGGGGCATGG + Intergenic
1117730506 14:58717205-58717227 GAGCTGTGTTTCCAGAGACATGG - Intergenic
1117830655 14:59746455-59746477 GGCAGGTGTTTCCAGTGCCATGG - Exonic
1120586590 14:86319271-86319293 GACAGGTGTTTCCTGTAGGAGGG + Intergenic
1126691375 15:51291306-51291328 GAGAGGTGTTTCCAGAGAAATGG + Intronic
1126714888 15:51504777-51504799 GAGATGTGTTTCCTTTGGCCAGG + Intronic
1127213764 15:56802609-56802631 GTGAGGTGTTTGCAGGGGAAGGG - Intronic
1129162768 15:73755984-73756006 GAGATGTGTTTGAACTGGCAAGG + Intergenic
1129654973 15:77518067-77518089 GAGGTTTGTTTCCAGAGGCAGGG - Intergenic
1129746453 15:78025047-78025069 CAGAGGTGTTTGCATTTGCAAGG - Intronic
1130605546 15:85313200-85313222 GGGAGGAGTCTCCTGTGGCAGGG + Intergenic
1130627089 15:85526719-85526741 GACAGGCGTTGCCAGGGGCAGGG - Intronic
1132536389 16:483236-483258 GAGCGGACTTTCCAGTAGCAGGG - Intronic
1135163041 16:20114419-20114441 GACAGGAATTTCCAGTGGCCAGG + Intergenic
1137347162 16:47674893-47674915 GAGAGCTGAATTCAGTGGCAGGG - Intronic
1138546193 16:57721390-57721412 GAGAGGTGTTTCTGGAGTCAGGG - Intronic
1139872004 16:70115079-70115101 GATAAGCTTTTCCAGTGGCAGGG + Intronic
1140363919 16:74367402-74367424 GATATGCGTTTCCAGTGGCAGGG - Intergenic
1144326038 17:14181184-14181206 GAGAAGTGTTTCAGGGGGCAAGG + Intronic
1144474910 17:15578072-15578094 GAGAAGTGTTTCAGGGGGCAAGG + Intronic
1146550328 17:33775261-33775283 GAGAGCTGTTTCAAGTTGCATGG + Intronic
1148527066 17:48349410-48349432 AAAATGTGTCTCCAGTGGCAAGG - Intronic
1149098641 17:52875833-52875855 GAAAGCTGTTTCCATTGACAAGG + Intronic
1149310843 17:55391544-55391566 GAGGGGTGTAAGCAGTGGCAGGG + Intergenic
1149570086 17:57666009-57666031 AAGAGATGTTTCCACTGCCAGGG + Intronic
1151656664 17:75499443-75499465 GAGCTGGGTTTCCAGTGCCACGG - Exonic
1153035481 18:758361-758383 TAGGGGTGTTTCCATTGACAGGG - Intronic
1153171995 18:2327246-2327268 TAGAGGAGTTTCCTGTTGCATGG - Intergenic
1153701184 18:7694715-7694737 GAAAAGGGTTTCCAGCGGCACGG - Intronic
1155565329 18:27127962-27127984 GAGACGTGTTTGGAGTGTCAAGG + Intronic
1159274108 18:66193490-66193512 GAGTGTTGTTTCCAGTGGACTGG - Intergenic
1162178589 19:8850218-8850240 AAAATGTGTTTGCAGTGGCAGGG - Intronic
1162681612 19:12347770-12347792 GAGAAGGGCTTCCAGCGGCAGGG - Intergenic
1163030606 19:14541669-14541691 GAGTGGTGTGTGCAGAGGCATGG + Intronic
1163370480 19:16898422-16898444 GAGACGTTTTCCCAGTGGGATGG - Intronic
1163478937 19:17543166-17543188 GAAAGGTGTTTCCTGGGACAAGG + Intronic
1163508408 19:17721327-17721349 GACTGGTGTGTCCAGTGGAAGGG + Intronic
1165903807 19:39181362-39181384 TAGAGTTGTTTCAAATGGCAGGG + Intronic
924999134 2:391273-391295 GAGAGATGGTTCCAGCTGCACGG + Intergenic
925577920 2:5379918-5379940 CACAGGAGATTCCAGTGGCAAGG + Intergenic
926633096 2:15155495-15155517 GAGAGGTGTCTTCAGCTGCAAGG - Intergenic
927853778 2:26515623-26515645 GGGATATGTTTCCAGTGGCACGG + Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
927909945 2:26890288-26890310 CAGAGTTGTCTCCAGTGGAAAGG + Intronic
930889504 2:56366960-56366982 GAGATGTGTTTCATGTGTCAGGG + Intronic
932334609 2:70922834-70922856 GAGAGGAGGCTGCAGTGGCAGGG + Intronic
937321508 2:120963686-120963708 GAGAGGTGTCTCAGGGGGCAGGG - Intronic
937832065 2:126434930-126434952 GAGAGGTGATTCTGGAGGCAGGG - Intergenic
939409717 2:141808761-141808783 GAGAGGGGTTGCCAGGGGCTAGG - Intronic
939696870 2:145337286-145337308 GAAAGATGCTGCCAGTGGCAAGG + Intergenic
940759829 2:157725779-157725801 TAGAGATGGATCCAGTGGCAAGG + Intergenic
948359457 2:237409096-237409118 GAGAGGTATGCCCAGTGACAGGG - Intronic
948444033 2:238018176-238018198 GGGAGGTGGTTCCAGAGGCTTGG + Intronic
1169497133 20:6125799-6125821 GCCAGGTGTTTGGAGTGGCAGGG + Intergenic
1170291563 20:14775759-14775781 GAGGGTTTTTTCTAGTGGCAAGG - Intronic
1170854773 20:20041401-20041423 GTGAGCTGTTTTCAGAGGCAAGG + Intronic
1171406491 20:24915359-24915381 CAGAGGTGTGGCCTGTGGCATGG - Intergenic
1173296541 20:41764236-41764258 AATAGGTGTCTCCAGTGTCAGGG - Intergenic
1173496909 20:43526067-43526089 CAGAGGTGTCTGCTGTGGCATGG + Intronic
1175845596 20:62057165-62057187 CAGAGGTGCTGCCGGTGGCAAGG - Intronic
1175851829 20:62097825-62097847 GATGGGTGTTGCCAGAGGCAGGG + Intergenic
1176244208 20:64089671-64089693 GAGAGGTGTCTGCAGTAGCAGGG + Intronic
1177886145 21:26748174-26748196 GACAGGTGTTTCCACTGTCCTGG + Intergenic
1178264747 21:31132584-31132606 GAGCTGTGGTCCCAGTGGCATGG - Intronic
1179877010 21:44273698-44273720 AAGGGGTATTTCCAGTGCCAGGG + Intergenic
1180927928 22:19568962-19568984 GAGAGACTTTTCCAGTTGCAAGG + Intergenic
1181772632 22:25137370-25137392 GAGAGGTGTTACCACAGGCCTGG - Intronic
1181942892 22:26492397-26492419 GAGAGGTGTTTCCAGGTGTATGG + Exonic
949359597 3:3217545-3217567 GAGAGGTATTTGCAGTGGAGAGG - Intergenic
952773841 3:37025846-37025868 GACAGATATTTCTAGTGGCAGGG + Exonic
956906993 3:73776746-73776768 GGGAGGTGTCTTCAGTGGGAAGG + Intergenic
958916668 3:100057776-100057798 GAGTGATTTTTCCAGTAGCAGGG - Intronic
959041178 3:101424497-101424519 GTGAGGTACTTCCAGGGGCAAGG - Intronic
959528830 3:107408770-107408792 GAGGGCTGCTGCCAGTGGCAAGG - Intergenic
960958787 3:123054450-123054472 GAGTGGTCTTTTGAGTGGCAGGG + Intergenic
960973385 3:123154805-123154827 GGGAGGTGGTTAGAGTGGCAAGG + Intronic
964734553 3:159903250-159903272 TAGAGGTGTTGGCCGTGGCAAGG - Intergenic
966429796 3:179819460-179819482 CAGAAGTGATACCAGTGGCATGG - Intronic
968458127 4:708750-708772 TAGAGGCGTTTCCAGTGTCCGGG + Intronic
969851508 4:9960750-9960772 GAGAGGTGATTCCAGGCCCAGGG + Intronic
974866284 4:67584767-67584789 GAGAGGAGATTCCAGAGTCAGGG + Intronic
975494987 4:75027374-75027396 GAGATGTGCTTCCCCTGGCATGG + Intronic
975949239 4:79748013-79748035 GAGAGGTGTTTGCATTGACGGGG - Intergenic
976045564 4:80942715-80942737 GAGATGTGCTTAGAGTGGCATGG - Intronic
977077130 4:92468909-92468931 GAGAGGTAGTTCCAGAGACAAGG + Intronic
977865740 4:102025474-102025496 GTGAGGTCTTTCCAGTTGGAAGG - Exonic
978656485 4:111071284-111071306 CATCGGTGCTTCCAGTGGCAGGG + Intergenic
979686426 4:123515229-123515251 CAGAGGTGCTCACAGTGGCATGG - Intergenic
982588786 4:157277199-157277221 GAGATTTGTTTCAAGTGGCAAGG + Intronic
985334045 4:188872459-188872481 GAGACATGTTTCCAGTGTCAAGG - Intergenic
985603512 5:847069-847091 GAGAGGTGTTTCCCTGAGCACGG - Intronic
985698049 5:1352974-1352996 AAGAGGGACTTCCAGTGGCAAGG - Intergenic
988152323 5:27400206-27400228 GAGAGTAGTTTCCAGAGGCTGGG + Intergenic
992218288 5:74546826-74546848 GAGAGGTGGTCCCAAGGGCAGGG - Intergenic
993142155 5:84048213-84048235 GACAAATGTTTCCAGTGGCCTGG + Intronic
995583987 5:113628140-113628162 GATAGGAGTGTCCATTGGCAAGG + Intergenic
997516911 5:134496398-134496420 GAGAGGTCTGTTCAGTCGCAGGG + Intergenic
1002157463 5:177294408-177294430 CAGAGGTCTTTCCAGTGGTTGGG - Exonic
1004286583 6:14326779-14326801 GAGAGGTATTTCCAGTTCTAAGG + Intergenic
1005479753 6:26244484-26244506 ACAAGCTGTTTCCAGTGGCAAGG + Intergenic
1006177303 6:32130133-32130155 GAGAGGTGATTCGAATGGCCCGG - Exonic
1007399126 6:41593826-41593848 GAGAGGGATCTCCAGGGGCACGG + Intronic
1007544727 6:42684900-42684922 GAGAGGTGTTTCCAGTGGCAGGG - Intronic
1014090232 6:117396286-117396308 GAGACGTGTTTCACATGGCATGG + Intronic
1014116764 6:117675523-117675545 GTGAGGTGTTGGCAGTGGAAAGG + Exonic
1015619763 6:135118690-135118712 GCCAGGTGTTTCCACTGGCAGGG - Intergenic
1015997166 6:139007035-139007057 GAGAGGGGTTTCCCATGGGAGGG + Intergenic
1017826724 6:158087046-158087068 GAGCCGTGTTTTCAGTAGCAGGG - Intronic
1027309929 7:76944788-76944810 GAGATGTGTCTCCACTTGCAAGG - Intergenic
1028301492 7:89206255-89206277 GAGAGGTTTTTCCCATGGCTTGG + Intronic
1029580417 7:101433471-101433493 GGGAGGTGTTTCCAGAGGGAGGG + Intronic
1032716291 7:134511863-134511885 TGGAGGTGTTTGCAGTGGCAAGG + Intergenic
1033660475 7:143398813-143398835 GTGAGGTGTTCCCAGTGTCAGGG - Exonic
1033660624 7:143399494-143399516 CAGAGATGTTTCCAGTAGAAGGG - Intronic
1034850250 7:154486755-154486777 GAGAGGTGTGTCTTGGGGCAGGG + Intronic
1035165499 7:156987151-156987173 GAAAGGCTTTTCCAGAGGCAGGG + Intergenic
1035654527 8:1295563-1295585 GAGAGCTGTTTCCAGGAGCGGGG - Intergenic
1036430657 8:8687093-8687115 GAGGGCTGTTTCCAGGGACATGG - Intergenic
1036521654 8:9497265-9497287 GAGAAGTATTTCCAGTGGGTTGG + Intergenic
1037410385 8:18589644-18589666 GATATGGGTTTCCAGTGGCAGGG + Intronic
1037923795 8:22829027-22829049 GAAAGGAGTTACCAGTGGCCTGG - Intronic
1038330717 8:26606932-26606954 GATAGGTATTTACATTGGCATGG + Intronic
1038918671 8:32056677-32056699 TAGAGGTATTTTCAGTGCCAAGG - Intronic
1039545712 8:38409704-38409726 GAGAGGTCTATCAAGTGGCCCGG - Intergenic
1040874709 8:52139248-52139270 GAGAGGTGTTTCAATTGCCTGGG + Intronic
1041913254 8:63112577-63112599 GAGAGCTGGGTGCAGTGGCATGG + Intergenic
1044811521 8:96068664-96068686 GAGAGGGGCCTTCAGTGGCAGGG - Intergenic
1045054812 8:98359877-98359899 GTGCCATGTTTCCAGTGGCATGG + Intergenic
1045720751 8:105107820-105107842 GGGATGGGATTCCAGTGGCAAGG - Intronic
1047498569 8:125425990-125426012 GAGAGGGAATTCCAGTGGGAGGG + Intergenic
1049692923 8:143970650-143970672 GAGCGGTGTTGCCAGGGGCTGGG - Intronic
1049720810 8:144114701-144114723 CAGAGGCCTTCCCAGTGGCAGGG - Intronic
1051592700 9:18792480-18792502 GGGAGATGTTTCCAGTGCCAGGG + Intronic
1053382071 9:37657256-37657278 GACAGGGGTTTCAACTGGCAGGG - Intronic
1056467675 9:86874089-86874111 GAGGGGTGTGTCCCGTGTCAAGG - Intergenic
1057174453 9:92985837-92985859 GAGGGGTGTGTCCTGTGGTATGG + Intronic
1058176265 9:101738790-101738812 GAGAGGACTTTCCAGGGGCGCGG - Intergenic
1059277653 9:113109367-113109389 GGAAGGAGTTTCCAGTGCCATGG + Intergenic
1059278598 9:113115184-113115206 GGAAGGAGTTTCCAGTGCCATGG - Intergenic
1060329514 9:122653750-122653772 GAGAGGGGTTTTAAGTGGTAAGG + Intergenic
1060511871 9:124240392-124240414 GAGAGGTGTTTCCTGTGGACTGG - Intergenic
1188003978 X:25005083-25005105 GAGAGGGCTTTCCTGGGGCAGGG + Intronic
1192080228 X:68040672-68040694 GATACCTGCTTCCAGTGGCAGGG - Intergenic
1192640056 X:72853388-72853410 AAGAGGGGATTCCAGTGACAGGG + Intergenic
1192641655 X:72867417-72867439 AAGAGGGGATTCCAGTGACAGGG - Intergenic
1193179034 X:78431687-78431709 AAAGGGTGTTTCCAGTGGGAAGG - Intergenic
1193359392 X:80562139-80562161 GAGAGCTGCTTCCATTGTCAGGG + Intergenic
1197347239 X:125338872-125338894 GAAAGGAGTGTCCAGTGGGAAGG - Intergenic
1197946561 X:131845489-131845511 AAAAGTTGTTTCCAGAGGCAGGG - Intergenic
1200055096 X:153456095-153456117 GAGAGGTGGGTCCCGTGGCTGGG - Intronic