ID: 1007549606

View in Genome Browser
Species Human (GRCh38)
Location 6:42718958-42718980
Sequence CTAAAGACACAATTAGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007549606_1007549612 22 Left 1007549606 6:42718958-42718980 CCCAGCCCTAATTGTGTCTTTAG 0: 1
1: 0
2: 1
3: 28
4: 267
Right 1007549612 6:42719003-42719025 GCCAAAGGTCCATTTTTCTCAGG No data
1007549606_1007549610 -10 Left 1007549606 6:42718958-42718980 CCCAGCCCTAATTGTGTCTTTAG 0: 1
1: 0
2: 1
3: 28
4: 267
Right 1007549610 6:42718971-42718993 GTGTCTTTAGACAAACTTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 152
1007549606_1007549614 23 Left 1007549606 6:42718958-42718980 CCCAGCCCTAATTGTGTCTTTAG 0: 1
1: 0
2: 1
3: 28
4: 267
Right 1007549614 6:42719004-42719026 CCAAAGGTCCATTTTTCTCAGGG 0: 1
1: 0
2: 0
3: 17
4: 207
1007549606_1007549611 7 Left 1007549606 6:42718958-42718980 CCCAGCCCTAATTGTGTCTTTAG 0: 1
1: 0
2: 1
3: 28
4: 267
Right 1007549611 6:42718988-42719010 TTGTGGAAAGTTAAAGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007549606 Original CRISPR CTAAAGACACAATTAGGGCT GGG (reversed) Intronic
901037395 1:6344468-6344490 CTAAAGAAAAAAGTAGGGCCGGG + Intronic
902834612 1:19038533-19038555 CCAAAGAAACAATTACAGCTGGG + Intergenic
903105467 1:21075271-21075293 GTAAAGACACACATAGGGCCGGG + Intronic
903241359 1:21984649-21984671 CTAAAGTTATAATTATGGCTGGG + Intronic
904022240 1:27475934-27475956 GTAAAGACATAAATAAGGCTGGG - Intronic
904530684 1:31166808-31166830 CTTAAAACACAGTTAGGGCTGGG + Intergenic
905189206 1:36220286-36220308 ATAAAAACAACATTAGGGCTGGG - Intergenic
906888375 1:49678060-49678082 CTAGTGAAACAATTAAGGCTTGG + Intronic
907539580 1:55201308-55201330 CAAAAGACTCAATTTAGGCTGGG + Intronic
907874023 1:58468216-58468238 ATAAAAACACACTAAGGGCTGGG - Intronic
909015961 1:70379880-70379902 CTTAAGACATAATTGGGGCCGGG - Intronic
911075919 1:93874787-93874809 CTAAAAACACAAATCCGGCTGGG - Intronic
912355573 1:109052487-109052509 CTAAAGTTAGAAATAGGGCTGGG - Intergenic
916657468 1:166888978-166889000 CCAAAGACATAATAAGGGCCTGG - Intergenic
917253526 1:173089043-173089065 CTAAACAAAAAATTAAGGCTGGG - Intergenic
917358860 1:174155089-174155111 CTCAAGAGACATTTAGGGCCAGG + Intergenic
917440727 1:175066754-175066776 CCCAAGACACAATGAGGACTTGG - Intergenic
918276406 1:182957397-182957419 TTAAAGACTTAATAAGGGCTGGG + Intergenic
919069139 1:192731909-192731931 CTAAAATCACAAAAAGGGCTGGG + Intergenic
919457584 1:197838444-197838466 TCAAAGAAACAATCAGGGCTGGG + Intergenic
919531781 1:198729986-198730008 CTAAAGACACATTTATGGATTGG + Intronic
921117414 1:212106804-212106826 CCACGGACACAGTTAGGGCTTGG - Intronic
923165378 1:231356416-231356438 CTAAAGTAAAAATTAAGGCTAGG - Intergenic
923987421 1:239397093-239397115 CTAAAGACATAAGTATAGCTTGG - Intronic
1065030522 10:21581339-21581361 TTAAAAACACAAATATGGCTGGG - Intronic
1065106929 10:22398430-22398452 CAAAAGACACCATTAAGCCTGGG + Intronic
1067255012 10:44629030-44629052 ATAAAGACAGAACTAGGGTTGGG - Intergenic
1069866102 10:71503859-71503881 CCAAAGGCACAATCAGGGCGAGG + Intronic
1070592083 10:77808558-77808580 ATAAAGGCACAAGTTGGGCTGGG - Intronic
1070927555 10:80235869-80235891 CTAAAGACACAGAGAGGACTTGG - Intergenic
1071541603 10:86489922-86489944 CTTAAGACACAGTTTTGGCTTGG + Intronic
1071720535 10:88139815-88139837 CTAAAGAAGCAATTAAGGCTGGG - Intergenic
1073643169 10:105273663-105273685 CAAAAGAGAAAATTAAGGCTTGG - Intergenic
1073772015 10:106745121-106745143 GTAAAGAAACAATAAGGGCCAGG + Intronic
1074026287 10:109639331-109639353 CTTAAGACACAATATAGGCTTGG + Intergenic
1078236804 11:9492406-9492428 AAAAATACAAAATTAGGGCTGGG - Intronic
1079362137 11:19777889-19777911 ATCAAGACACAATGGGGGCTCGG - Intronic
1080622170 11:33996121-33996143 AGAAAGAAACATTTAGGGCTGGG - Intergenic
1081153668 11:39663529-39663551 CCAAAGAAACAATTAGGGAAGGG - Intergenic
1081479389 11:43470987-43471009 CTAAGGAGACAATTAGAGATGGG - Intronic
1083557589 11:63643893-63643915 CTAAAGACACATATAGAACTTGG + Intronic
1084434139 11:69128543-69128565 TTAAAACCACAATGAGGGCTGGG + Intergenic
1085199931 11:74695806-74695828 TTAAAGACACCATTAGGGCCAGG - Intergenic
1085292756 11:75411683-75411705 CTTAAGACATATTAAGGGCTGGG - Intronic
1086063469 11:82723472-82723494 CTAAAGATATGATTAAGGCTGGG + Intergenic
1086921485 11:92592613-92592635 CTAAAAAGACAATTAGGGCCAGG - Intronic
1087216254 11:95498416-95498438 CCAAAGACAGAATTTGGCCTGGG - Intergenic
1088249745 11:107852254-107852276 CTAAAAACACAATATTGGCTGGG + Intronic
1088774428 11:113068719-113068741 CTAAAGTCACAAGCAGGGCCTGG - Intronic
1089843805 11:121442337-121442359 ATTAAGACTCAATTGGGGCTGGG + Intergenic
1091365854 11:135019793-135019815 CTATAGACAGAATCAGGGCTGGG - Intergenic
1094254778 12:28410815-28410837 TTAAAAACACAATTAAGGCTGGG - Intronic
1095888850 12:47216833-47216855 CTAAAGAGACAACTGGTGCTTGG + Intronic
1097437981 12:59573959-59573981 TTAAAGACACATTTATGGCTGGG + Intergenic
1097448882 12:59711801-59711823 CATAAGATGCAATTAGGGCTGGG - Intronic
1098289102 12:68938251-68938273 CTTAAAACACATTTAGGGATGGG + Intronic
1100501532 12:95179198-95179220 CTAAAGACATAATCAGAGCCGGG + Intronic
1100566906 12:95804802-95804824 CTATAAACACAATTAGGACGAGG + Intronic
1101141497 12:101800461-101800483 CTTAGAACAAAATTAGGGCTAGG + Intronic
1101624336 12:106424147-106424169 TAAAAGACACCATGAGGGCTGGG - Intronic
1102112193 12:110372816-110372838 CTAAAGAGACATATAAGGCTAGG - Intergenic
1102314454 12:111875715-111875737 CTAAAGGCAAAATGTGGGCTAGG - Intronic
1104038092 12:125112383-125112405 ATAAAGACATACTGAGGGCTGGG + Intronic
1104897890 12:132173223-132173245 CTAAAGCCACAAACAGGGCGAGG + Intergenic
1105386973 13:19939317-19939339 CAAAAGACAAAATTACGGCTGGG - Intergenic
1106717539 13:32406763-32406785 CTAAAGACAGATTTAGGGCCAGG - Intronic
1107456729 13:40562437-40562459 CTTAAGACACATTAGGGGCTAGG - Intronic
1108752820 13:53465487-53465509 CTTAAAACACAGTTCGGGCTGGG - Intergenic
1109448039 13:62471057-62471079 TTAATGACACAATCTGGGCTGGG + Intergenic
1111815309 13:93145548-93145570 ATAAAGACACAACTAAGCCTGGG - Intergenic
1112402789 13:99089953-99089975 ATAAAGACACCATTCAGGCTGGG - Intergenic
1112821495 13:103342317-103342339 CTAAACACAAAATTAGTGCAAGG - Intergenic
1115620162 14:35133212-35133234 GAAAATACACAGTTAGGGCTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119645653 14:76346538-76346560 CTCAAGACACCATGGGGGCTTGG + Intronic
1120499078 14:85271549-85271571 ATAAAGACACATTTGGGACTTGG + Intergenic
1121029229 14:90643876-90643898 TTAAAAACAAACTTAGGGCTGGG - Intronic
1121088212 14:91162960-91162982 TTAAAGATACAATTTGTGCTGGG + Intronic
1121411597 14:93752312-93752334 GTAAAGTCACAGTCAGGGCTTGG + Intronic
1121917343 14:97847725-97847747 GTAAAGAAACAATCAGGTCTGGG - Intergenic
1122667187 14:103338929-103338951 CTAAAGGCACAAACAAGGCTGGG - Intronic
1124477372 15:30046127-30046149 CTAAAGAAACATTTTGGTCTTGG - Intergenic
1125411755 15:39413560-39413582 GTAAATACACAAATAAGGCTTGG + Intergenic
1125781254 15:42270433-42270455 CAAAATACGCAGTTAGGGCTGGG + Intronic
1127540337 15:59931540-59931562 CTAAAGACACAGTTAGGTCTAGG - Intergenic
1128906973 15:71476000-71476022 CTAAAGACACAGTTAGTGAATGG - Intronic
1128964579 15:72045559-72045581 CCAAAAACTCATTTAGGGCTGGG - Intronic
1129605190 15:77021394-77021416 TTAAAGACAGCATTAGGGCCAGG + Intronic
1130291667 15:82607290-82607312 TCAAAGACACAAATAGGGCTGGG + Intronic
1131961726 15:97796431-97796453 CTAAAGAGAGAAGTAGGGCTTGG + Intergenic
1133262536 16:4560650-4560672 TCAAAGACACAAATAGGGCCAGG + Intronic
1133564438 16:6980002-6980024 ATAATGACACCATTAAGGCTGGG - Intronic
1133835418 16:9363285-9363307 CTAAAAAGACCATGAGGGCTGGG - Intergenic
1134303116 16:13008819-13008841 CTAAAGACATACTTAAGACTGGG - Intronic
1134401105 16:13910507-13910529 CTAAAAACACCATCTGGGCTTGG + Intergenic
1134485048 16:14651345-14651367 ATAAAGAGACACTTAGGGCAAGG + Intronic
1134682135 16:16133698-16133720 ATAAAGACTCAACAAGGGCTGGG - Intronic
1134694414 16:16212603-16212625 CTAAATACACCGTCAGGGCTGGG - Intronic
1134977419 16:18582027-18582049 CTAAATACACCGTCAGGGCTGGG + Intergenic
1135020657 16:18960265-18960287 CAAAAGAAAAAAATAGGGCTGGG - Intergenic
1135300671 16:21324080-21324102 CAAAAGACATAATCAGGGCCAGG - Intergenic
1135727318 16:24866301-24866323 TCAAAGATACAAATAGGGCTGGG + Intronic
1136233239 16:28899997-28900019 GGAAAGACACGATTTGGGCTGGG + Intronic
1138046627 16:53732020-53732042 ATAAGGCCACAATGAGGGCTGGG - Intronic
1139013074 16:62657112-62657134 GTAAAGACACACTGTGGGCTGGG - Intergenic
1139874253 16:70132782-70132804 CTAAACACACACAAAGGGCTAGG - Intronic
1144280839 17:13724748-13724770 CTAAAGAAACAACATGGGCTGGG - Intergenic
1146303913 17:31715214-31715236 CTAGAGACTCAATTAGTTCTTGG + Intergenic
1148195484 17:45709870-45709892 CTCAAGACTCAAGTAAGGCTTGG - Intergenic
1149509065 17:57222931-57222953 GTAAACACACAAATAGGTCTGGG + Intergenic
1149611946 17:57964095-57964117 TAAAAGACATAATTAGGGCCAGG + Intergenic
1149760165 17:59221340-59221362 CCAAGGTCACAATTAGAGCTAGG + Intronic
1149902079 17:60489738-60489760 TTAAAAACAAAAGTAGGGCTGGG + Intronic
1150543656 17:66130478-66130500 ATAAAAACACAATTATGGTTGGG + Intronic
1151289031 17:73135410-73135432 ATAAAGACACTACTGGGGCTGGG + Intergenic
1151300626 17:73222480-73222502 CTCAAAACAAAACTAGGGCTGGG + Intronic
1151417446 17:73975638-73975660 CTAAAGACATAAGTTGGGCTGGG - Intergenic
1152403937 17:80085963-80085985 CAAAAAGCAAAATTAGGGCTGGG - Intronic
1152715337 17:81897292-81897314 CTAAAAATACAACAAGGGCTGGG - Intronic
1155021188 18:21898308-21898330 GTAAAGAATGAATTAGGGCTGGG - Intergenic
1155740176 18:29279630-29279652 ATGAAGACAGAATTAGGGATGGG + Intergenic
1156242842 18:35270464-35270486 CTAAAGAAAGAATTAGTGATTGG - Intronic
1157237097 18:45975234-45975256 AAAAATACAAAATTAGGGCTGGG - Intergenic
1157394394 18:47329677-47329699 ATAAAAACACACTCAGGGCTGGG - Intergenic
1157663757 18:49468275-49468297 CAAAAGACAAAATTAGGATTGGG - Intergenic
1157969687 18:52251931-52251953 CTAAAAAGACCATTAGGTCTTGG - Intergenic
1158620878 18:59031616-59031638 CTTAAGACCCGAATAGGGCTGGG - Intergenic
1159428546 18:68321249-68321271 TTAAAGACATAATGAGGTCTTGG + Intergenic
1159553187 18:69918255-69918277 CTAAAGAAGCTATTAGGGCCAGG + Intronic
1161889575 19:7024895-7024917 TTTAAGACACAATTAGGGCCGGG - Intergenic
1161891877 19:7045851-7045873 TTTAAGACACAATTAGGGCCGGG + Intergenic
1162525813 19:11205636-11205658 CTAAAAATACAAATATGGCTGGG - Intronic
1162854535 19:13458444-13458466 TTAAAGTGACATTTAGGGCTGGG - Intronic
1163360930 19:16846066-16846088 TTAAAGAAACAATTTAGGCTGGG - Intronic
1164963517 19:32458142-32458164 CTGAAGGCAAAATTTGGGCTTGG + Exonic
1165370947 19:35405709-35405731 CTAAAAACAAACTTGGGGCTGGG + Intergenic
1165808904 19:38598716-38598738 TTAAAGACTAACTTAGGGCTGGG + Intronic
1167143352 19:47667308-47667330 CTAAAGACATGAATAGGGCCAGG - Intronic
1167589732 19:50397696-50397718 TTAAAGACATAATCAGGGCCGGG - Intronic
1168551378 19:57298761-57298783 CTAAAGACACAAATATGGCCAGG - Intergenic
1168601025 19:57718744-57718766 AAAAATACAAAATTAGGGCTGGG + Intronic
928272358 2:29867888-29867910 CTACAGACACAGTTGGGGATGGG + Intronic
929939731 2:46324360-46324382 ATAAAAACATAATTAGGGCTGGG - Intronic
931406616 2:61985343-61985365 ATAAAGACACACATAGGGCCGGG - Intronic
932294088 2:70609846-70609868 TTAAAGACACATTTATGGCCAGG + Intronic
932482015 2:72048363-72048385 CTAAAAATACAATTAGCTCTGGG + Intergenic
933664764 2:84956009-84956031 AAAAATACAAAATTAGGGCTGGG + Intergenic
934496091 2:94800976-94800998 CTAAAGAAAAACTGAGGGCTGGG + Intergenic
935678993 2:105619988-105620010 CTAAAGACACTATAAAGGTTTGG + Intergenic
940090112 2:149905841-149905863 CTAAAGAAACAATAGCGGCTGGG + Intergenic
942030164 2:171951104-171951126 TTAAAAACACAATAAGGGCCTGG - Intronic
942967400 2:181913360-181913382 TAAAAAACACAGTTAGGGCTGGG - Intronic
943171400 2:184405789-184405811 TTAAAATCACAATGAGGGCTGGG + Intergenic
943675942 2:190716649-190716671 CTAGAGACAGAATTAGGACTGGG + Intergenic
943865841 2:192923841-192923863 CTAAAGAGTCAACTTGGGCTTGG - Intergenic
944318511 2:198308991-198309013 CTGAAGGCATAATTAGGGCCAGG - Intronic
945764182 2:213953448-213953470 CTAAAGAAACATTTAGGTCTTGG + Intronic
945797766 2:214386077-214386099 AAAAAGACAAAAGTAGGGCTGGG + Intronic
947805914 2:232967909-232967931 TTAAAGAAATAATGAGGGCTGGG + Intronic
1169007609 20:2221622-2221644 CTGAAAAGACAAGTAGGGCTTGG - Intergenic
1173328272 20:42053105-42053127 CTAAAGGCTGAATTAGAGCTTGG + Intergenic
1173642362 20:44612813-44612835 CTCAGGAAACAATTAGGGATGGG + Intronic
1173738118 20:45375967-45375989 ATAACAACACAATTGGGGCTTGG + Intronic
1174341225 20:49897323-49897345 TAAAAGACACAAATAGGGCCAGG + Intergenic
1174831558 20:53817805-53817827 CCAAAGACACACATAGAGCTGGG - Intergenic
1176851436 21:13919800-13919822 CTAAAGAAAAATTGAGGGCTGGG + Intergenic
1177086499 21:16711646-16711668 TTAAAAACACACATAGGGCTGGG - Intergenic
1183471660 22:38010910-38010932 CAAAAGACACCATTAAGGCTGGG - Intronic
1184858168 22:47157851-47157873 GTAAAGAAAGAATGAGGGCTTGG - Intronic
949553735 3:5134080-5134102 CTGAAGACAAAATTAGGAATTGG - Intronic
949727235 3:7063238-7063260 ATCAAGACACAAGTAAGGCTTGG + Intronic
951230192 3:20169722-20169744 CTGAACATACAATTAGAGCTTGG + Intronic
954012917 3:47658822-47658844 CAAGAGACAGAATGAGGGCTAGG + Intronic
954049991 3:47967039-47967061 TTAAAAACACATTTAGGGCCGGG + Intronic
954512945 3:51143563-51143585 TTAAAAACACAGTGAGGGCTGGG - Intronic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
959870627 3:111323337-111323359 ATAAAGGCAGAATTAGGGCAAGG - Intronic
962790309 3:138805372-138805394 TTAAAAACAGAATTAGGGGTCGG + Intronic
963290335 3:143480764-143480786 TTAAAGACACAAATATGCCTAGG + Intronic
965489442 3:169318801-169318823 ATAAAGACACATGCAGGGCTGGG + Intronic
966067566 3:175835182-175835204 CTAAAGAGTCAATTTGGGCCTGG - Intergenic
966164599 3:177003617-177003639 TGAAAGACACCATTAAGGCTGGG + Intergenic
966848688 3:184150520-184150542 ATATATACAAAATTAGGGCTGGG + Intronic
967306414 3:188063937-188063959 CTAAAGAGAAAATTCGAGCTAGG - Intergenic
967650772 3:191983513-191983535 CTAAAGAAAACATAAGGGCTTGG + Intergenic
968412279 4:400568-400590 CTAAAGAGTCAACTAGGGCTTGG + Intergenic
970378065 4:15479195-15479217 TCAAAGACAGAATTTGGGCTTGG - Intronic
972063329 4:34909247-34909269 ATAAAGACACACCTGGGGCTGGG - Intergenic
973080064 4:45979755-45979777 ATAAATACACATTTAGGGCCGGG - Intergenic
973548578 4:52007479-52007501 CAAAAGTCACAAACAGGGCTGGG - Intronic
973682864 4:53339472-53339494 TTAAAAACACTGTTAGGGCTCGG + Intronic
976825911 4:89260100-89260122 TTAAAGACCCAAGTAGGGCCAGG - Intronic
979896191 4:126160996-126161018 CTAAAGAGAGAATTGGGGCTGGG + Intergenic
981596103 4:146424363-146424385 TTAAATACAGAATAAGGGCTGGG + Intronic
983168587 4:164510062-164510084 ATTAAGACATAATTAGAGCTTGG + Intergenic
983940787 4:173532316-173532338 ATAAAAACACATTTAGGCCTTGG + Intergenic
985010374 4:185576262-185576284 ATAAAAACACAGTTAGGGCCAGG - Intergenic
985664650 5:1175763-1175785 CTAAAGACACGATTTTGCCTCGG - Intergenic
985942059 5:3144322-3144344 TTAAAAACAGAATTACGGCTGGG - Intergenic
987028503 5:13952646-13952668 TTAAAGACATAATTAGGTCCTGG - Intergenic
988568163 5:32337685-32337707 TTAAAGACACAATTGAGGCCGGG + Intergenic
991200310 5:63984492-63984514 CTAAATAGACAAGTACGGCTAGG + Intergenic
991273983 5:64821728-64821750 TTAAAAACACAATTAGGGAAAGG - Intronic
992087949 5:73294812-73294834 TTAAAGCCACAACTAGGCCTTGG - Intergenic
993003830 5:82410122-82410144 CTAAGGTCACAATTAGGGGAAGG + Intergenic
993035925 5:82757225-82757247 CAAAAGAAAGAATAAGGGCTAGG - Intergenic
993684038 5:90916141-90916163 ATAAAAACATAATTAAGGCTAGG - Intronic
993752245 5:91684634-91684656 CTAAATGAACAATTAGGACTTGG + Intergenic
993855071 5:93064181-93064203 CTAAAGACACATTGAGGGTTAGG + Intergenic
995117812 5:108501130-108501152 CCAAAGACACAATGAGGGTATGG - Intergenic
996289535 5:121835450-121835472 CTGAAGACAGAATTCGGGCCAGG - Intergenic
996916208 5:128714914-128714936 CAAAAGAAACAATTAGGCTTAGG - Intronic
998013942 5:138717479-138717501 CTACAGACACAATAAAGGATGGG - Intronic
1003993782 6:11516900-11516922 ATAAAGACAGAATTAGAGTTTGG + Intergenic
1004299818 6:14447060-14447082 CAAAAGAAAAAATTTGGGCTGGG - Intergenic
1004711049 6:18170773-18170795 CTAAAGAAACAATCAGGGCCAGG - Intronic
1004947339 6:20630219-20630241 CCAGAGACACAAGGAGGGCTGGG - Intronic
1005073378 6:21883366-21883388 ACAAAGAAACAATCAGGGCTGGG - Intergenic
1006371091 6:33643895-33643917 GTAAAGAGAAAAATAGGGCTGGG + Intronic
1006596028 6:35192898-35192920 CTAAAGAGAAAATTATGCCTGGG - Intergenic
1006872477 6:37264591-37264613 TATAAGACACAATCAGGGCTGGG - Intronic
1007549606 6:42718958-42718980 CTAAAGACACAATTAGGGCTGGG - Intronic
1008411573 6:51186518-51186540 TTAAAGGGATAATTAGGGCTTGG + Intergenic
1008705450 6:54153005-54153027 CTGAGGATAAAATTAGGGCTGGG + Intronic
1010221067 6:73449698-73449720 CTCAAGACACAGTCTGGGCTGGG + Intronic
1011492707 6:87908864-87908886 ATAAAGACAGAAGTAGGGGTGGG - Intergenic
1011604893 6:89093452-89093474 CTAAAGAAACAACTATGGCCAGG - Intergenic
1012591991 6:100993159-100993181 CTTAAGAAACATTTGGGGCTTGG - Intergenic
1013649874 6:112183653-112183675 CTCAAGAAAGAATTAAGGCTGGG + Intronic
1015796677 6:137019422-137019444 TTAAAAAAACAAATAGGGCTGGG - Intronic
1016760306 6:147729259-147729281 ATAAAGTCACATTTGGGGCTAGG + Intronic
1017318114 6:153055982-153056004 CTAAAAACACTGTTAAGGCTAGG + Intronic
1017483481 6:154881355-154881377 CAAAAACCACAATTATGGCTGGG + Intronic
1018243674 6:161802254-161802276 TTAAAGTCACCATTAGGACTTGG - Intronic
1018481939 6:164199716-164199738 CAAAACAAAAAATTAGGGCTGGG + Intergenic
1018626067 6:165779963-165779985 CTTAAGACACCAGCAGGGCTAGG - Intronic
1020040663 7:4998436-4998458 CCACAGACACATTTAGGGCCAGG + Intronic
1020134593 7:5579932-5579954 CTAAAAACACAAATATGGCCGGG + Intergenic
1022827321 7:34028944-34028966 CTAAAGACAGAATTAGAATTTGG + Intronic
1023257520 7:38326794-38326816 CTAAAGACACAACCAGAGGTGGG - Intergenic
1024171042 7:46786867-46786889 CTAAAGATACAATTACTGCAGGG + Intergenic
1024673025 7:51613792-51613814 CTATAGACAGACTCAGGGCTAGG - Intergenic
1024711939 7:52025744-52025766 TTAAAGAGACAATGAGGGCATGG + Intergenic
1024777642 7:52806383-52806405 CTAAAGACACAAAATGAGCTTGG + Intergenic
1030791460 7:113734172-113734194 ATAAAGAGACAAATAGGGCAAGG - Intergenic
1033172930 7:139100234-139100256 TTAAAACCACAATGAGGGCTGGG + Intronic
1033366580 7:140676724-140676746 CTAAAAACTCTGTTAGGGCTGGG + Intronic
1034065948 7:148136566-148136588 ATAAAGAAATACTTAGGGCTGGG - Intronic
1035322383 7:158041340-158041362 ATAAAGAAACAATTGAGGCTGGG + Intronic
1035422149 7:158738746-158738768 TTAAATACACAAATATGGCTTGG - Intronic
1038018008 8:23530750-23530772 CTCAAGACACCAGTAGGACTAGG - Intronic
1039237248 8:35515387-35515409 CAAAATACAGATTTAGGGCTGGG + Intronic
1039857426 8:41428231-41428253 CAAAAGAAACAATGAGGGCCGGG + Intergenic
1039908407 8:41804153-41804175 CTGAAGGCCCAACTAGGGCTGGG + Intronic
1042657747 8:71118895-71118917 CTACAGAAAGAAATAGGGCTTGG - Intergenic
1043404416 8:79916062-79916084 CTATAGAAACAATTGGGGGTGGG - Intergenic
1044963371 8:97552726-97552748 CAAAATTCAGAATTAGGGCTGGG + Intergenic
1046000048 8:108409576-108409598 CTAAAAATACAAAGAGGGCTAGG + Intronic
1046367125 8:113249253-113249275 ATAAAGACACACTCAAGGCTGGG - Intronic
1052782676 9:32796913-32796935 ATAAAGACACACTCAAGGCTGGG + Intergenic
1052875984 9:33564255-33564277 CTAAAGAAAAATTGAGGGCTGGG - Intronic
1053385115 9:37680912-37680934 GAAAAGAAACAATTTGGGCTGGG + Intronic
1053500026 9:38580106-38580128 CTAAAGAAAAATTGAGGGCTGGG + Intergenic
1053534487 9:38912472-38912494 AAAAATACAAAATTAGGGCTGGG - Intergenic
1053661050 9:40279405-40279427 CTAAAGAAAAACTGAGGGCTGGG - Intronic
1053911428 9:42908742-42908764 CTAAAGAAAAACTGAGGGCTGGG - Intergenic
1054206708 9:62136891-62136913 AAAAATACAAAATTAGGGCTGGG - Intergenic
1054373170 9:64425620-64425642 CTAAAGAAAAACTGAGGGCTGGG - Intergenic
1054523560 9:66096879-66096901 CTAAAGAAAAACTGAGGGCTGGG + Intergenic
1054631644 9:67451456-67451478 AAAAATACAAAATTAGGGCTGGG + Intergenic
1054680801 9:67915398-67915420 CTAAAGAAAAACTGAGGGCTGGG - Intergenic
1055185897 9:73453517-73453539 CTAAAGAAAAAATTATGGCTGGG - Intergenic
1055239909 9:74171185-74171207 CTAAATACATAATTAGGTTTAGG - Intergenic
1056740045 9:89246546-89246568 CAAAAGGCATGATTAGGGCTGGG - Intergenic
1057091700 9:92263861-92263883 CTAAAAACAGAATTTGTGCTGGG + Intronic
1057679447 9:97164784-97164806 CTAAAGAAAAATTGAGGGCTGGG + Intergenic
1057685542 9:97230884-97230906 CTCAAGAAACATTTAGGGCCAGG + Intergenic
1058922935 9:109634860-109634882 CTATAGATAGAATTATGGCTTGG - Intergenic
1060887954 9:127168804-127168826 CTAAGGACAAAAGTGGGGCTGGG - Intronic
1060898706 9:127238446-127238468 CTCAAGGCACACCTAGGGCTTGG + Intronic
1061044134 9:128155302-128155324 AAAAAAACACAATTAGGGATGGG - Intergenic
1185703222 X:2247357-2247379 ATAAAAAAAAAATTAGGGCTGGG + Intronic
1185977652 X:4739534-4739556 CTAAAGATACATTTTAGGCTGGG - Intergenic
1186572618 X:10731660-10731682 AAAAAGACTAAATTAGGGCTGGG + Intronic
1187156919 X:16728740-16728762 ATAAAGACACAGTTGAGGCTGGG + Intronic
1187336499 X:18386494-18386516 CTAAAAATAAATTTAGGGCTGGG - Intergenic
1187870799 X:23763618-23763640 TTAAAAACAAAAATAGGGCTGGG - Intronic
1188415212 X:29924885-29924907 CTAAAGATACTTTTAGGTCTAGG - Intronic
1190582565 X:51903234-51903256 CTGAGGACAAAATTAGGCCTAGG + Intergenic
1192489119 X:71558650-71558672 CTAAAAACAAAATTATGGCTGGG - Intronic
1192812745 X:74561449-74561471 ATAAAGACACACATAGGGCTGGG + Intergenic
1192882969 X:75307182-75307204 ATAAAAACACAAATAGGGCTGGG - Intergenic
1193904880 X:87230502-87230524 CTAAAGATAAAAATAAGGCTGGG + Intergenic
1194909648 X:99625472-99625494 CTAAAAACAAATTCAGGGCTGGG + Intergenic
1199711946 X:150475823-150475845 CTACAGGCTCAATCAGGGCTAGG + Intronic
1200136429 X:153877146-153877168 AAAAATACAAAATTAGGGCTGGG + Intronic
1201264336 Y:12191581-12191603 CTAAATGCAAAATCAGGGCTAGG - Intergenic