ID: 1007553192

View in Genome Browser
Species Human (GRCh38)
Location 6:42745867-42745889
Sequence CGCTCGCTCCCGAACAAAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007553182_1007553192 26 Left 1007553182 6:42745818-42745840 CCTCCAGCCGCTCGACCGACTCC 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1007553192 6:42745867-42745889 CGCTCGCTCCCGAACAAAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 19
1007553181_1007553192 29 Left 1007553181 6:42745815-42745837 CCTCCTCCAGCCGCTCGACCGAC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1007553192 6:42745867-42745889 CGCTCGCTCCCGAACAAAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 19
1007553188_1007553192 -4 Left 1007553188 6:42745848-42745870 CCAGAAGCTCTTCCACGGCCGCT 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1007553192 6:42745867-42745889 CGCTCGCTCCCGAACAAAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 19
1007553184_1007553192 19 Left 1007553184 6:42745825-42745847 CCGCTCGACCGACTCCGCGCGCT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1007553192 6:42745867-42745889 CGCTCGCTCCCGAACAAAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 19
1007553186_1007553192 5 Left 1007553186 6:42745839-42745861 CCGCGCGCTCCAGAAGCTCTTCC 0: 1
1: 0
2: 1
3: 14
4: 132
Right 1007553192 6:42745867-42745889 CGCTCGCTCCCGAACAAAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 19
1007553183_1007553192 23 Left 1007553183 6:42745821-42745843 CCAGCCGCTCGACCGACTCCGCG 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1007553192 6:42745867-42745889 CGCTCGCTCCCGAACAAAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 19
1007553185_1007553192 11 Left 1007553185 6:42745833-42745855 CCGACTCCGCGCGCTCCAGAAGC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1007553192 6:42745867-42745889 CGCTCGCTCCCGAACAAAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007553192 Original CRISPR CGCTCGCTCCCGAACAAAGG TGG Exonic
923041407 1:230322557-230322579 CGCTGGCTTCCGAACAGACGTGG - Intronic
1073136587 10:101223767-101223789 CGCTCGGTCCCGCACAATGTGGG - Intergenic
1077630444 11:3808006-3808028 CGCCCTCTCCTGAACAAAGGCGG + Intronic
1078591675 11:12646404-12646426 CACTCCTTCCCCAACAAAGGAGG - Intergenic
1118013234 14:61631540-61631562 CACTCGCTCCCCAACACATGGGG + Intronic
1121666599 14:95677044-95677066 CTCTGGCTCCCGAACAAAAAGGG - Intergenic
1133770825 16:8866645-8866667 CGCTCTCCCCGGAACAATGGAGG - Intronic
1143541800 17:7573518-7573540 CGCTCACCCCCGAAGGAAGGTGG - Intronic
1147598955 17:41734170-41734192 CTCCAGCTCCCGAATAAAGGCGG + Exonic
1160453642 18:78980795-78980817 CGCGGGCCCCCGAACAAAGCTGG - Intronic
926145598 2:10395505-10395527 CCCTCGCTCCTGCACAATGGGGG - Intronic
935013244 2:99155243-99155265 CGGTTGATCCCGAACACAGGAGG + Intronic
941888043 2:170549848-170549870 CGCTCCCTTCCAAACACAGGCGG - Intronic
942241171 2:173964893-173964915 CGCCCGCGCCCGCACACAGGGGG + Intronic
944663108 2:201937599-201937621 CGCTCCCTCCCTAACACTGGGGG + Intergenic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1175525094 20:59628328-59628350 CCCTGGCTCCCGAGCAGAGGCGG + Intronic
1181057877 22:20268399-20268421 CGCGCGGTCCCAGACAAAGGCGG + Exonic
1182459607 22:30474439-30474461 GGCTCTCTCCCTAACTAAGGTGG - Intergenic
1007553192 6:42745867-42745889 CGCTCGCTCCCGAACAAAGGTGG + Exonic
1034462052 7:151203446-151203468 CCCTCGCTCCCGCACAGTGGTGG + Exonic