ID: 1007553381

View in Genome Browser
Species Human (GRCh38)
Location 6:42746707-42746729
Sequence TAGGGGGGAGGGGGGCGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007553381_1007553402 23 Left 1007553381 6:42746707-42746729 CCTTACCGCCCCCCTCCCCCCTA No data
Right 1007553402 6:42746753-42746775 GGGGGCTCCTGGATCCCCGCAGG No data
1007553381_1007553389 -8 Left 1007553381 6:42746707-42746729 CCTTACCGCCCCCCTCCCCCCTA No data
Right 1007553389 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
1007553381_1007553400 12 Left 1007553381 6:42746707-42746729 CCTTACCGCCCCCCTCCCCCCTA No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553381_1007553399 5 Left 1007553381 6:42746707-42746729 CCTTACCGCCCCCCTCCCCCCTA No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data
1007553381_1007553394 -3 Left 1007553381 6:42746707-42746729 CCTTACCGCCCCCCTCCCCCCTA No data
Right 1007553394 6:42746727-42746749 CTATCCACTGCAGTTCGGCGCGG No data
1007553381_1007553397 3 Left 1007553381 6:42746707-42746729 CCTTACCGCCCCCCTCCCCCCTA No data
Right 1007553397 6:42746733-42746755 ACTGCAGTTCGGCGCGGCCTGGG No data
1007553381_1007553398 4 Left 1007553381 6:42746707-42746729 CCTTACCGCCCCCCTCCCCCCTA No data
Right 1007553398 6:42746734-42746756 CTGCAGTTCGGCGCGGCCTGGGG No data
1007553381_1007553396 2 Left 1007553381 6:42746707-42746729 CCTTACCGCCCCCCTCCCCCCTA No data
Right 1007553396 6:42746732-42746754 CACTGCAGTTCGGCGCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007553381 Original CRISPR TAGGGGGGAGGGGGGCGGTA AGG (reversed) Intergenic
No off target data available for this crispr