ID: 1007553389

View in Genome Browser
Species Human (GRCh38)
Location 6:42746722-42746744
Sequence CCCCCCTATCCACTGCAGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007553373_1007553389 20 Left 1007553373 6:42746679-42746701 CCCATTTCTGCCTCCCCGTAGCC No data
Right 1007553389 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
1007553369_1007553389 27 Left 1007553369 6:42746672-42746694 CCCCCAACCCATTTCTGCCTCCC No data
Right 1007553389 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
1007553376_1007553389 7 Left 1007553376 6:42746692-42746714 CCCCGTAGCCCTCATCCTTACCG No data
Right 1007553389 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
1007553378_1007553389 5 Left 1007553378 6:42746694-42746716 CCGTAGCCCTCATCCTTACCGCC No data
Right 1007553389 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
1007553371_1007553389 25 Left 1007553371 6:42746674-42746696 CCCAACCCATTTCTGCCTCCCCG No data
Right 1007553389 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
1007553379_1007553389 -1 Left 1007553379 6:42746700-42746722 CCCTCATCCTTACCGCCCCCCTC No data
Right 1007553389 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
1007553370_1007553389 26 Left 1007553370 6:42746673-42746695 CCCCAACCCATTTCTGCCTCCCC No data
Right 1007553389 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
1007553375_1007553389 10 Left 1007553375 6:42746689-42746711 CCTCCCCGTAGCCCTCATCCTTA No data
Right 1007553389 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
1007553377_1007553389 6 Left 1007553377 6:42746693-42746715 CCCGTAGCCCTCATCCTTACCGC No data
Right 1007553389 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
1007553380_1007553389 -2 Left 1007553380 6:42746701-42746723 CCTCATCCTTACCGCCCCCCTCC No data
Right 1007553389 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
1007553381_1007553389 -8 Left 1007553381 6:42746707-42746729 CCTTACCGCCCCCCTCCCCCCTA No data
Right 1007553389 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
1007553372_1007553389 24 Left 1007553372 6:42746675-42746697 CCAACCCATTTCTGCCTCCCCGT No data
Right 1007553389 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
1007553374_1007553389 19 Left 1007553374 6:42746680-42746702 CCATTTCTGCCTCCCCGTAGCCC No data
Right 1007553389 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007553389 Original CRISPR CCCCCCTATCCACTGCAGTT CGG Intergenic
No off target data available for this crispr