ID: 1007553393

View in Genome Browser
Species Human (GRCh38)
Location 6:42746726-42746748
Sequence CGCGCCGAACTGCAGTGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007553393_1007553409 20 Left 1007553393 6:42746726-42746748 CCTATCCACTGCAGTTCGGCGCG No data
Right 1007553409 6:42746769-42746791 CCGCAGGCAGTTACTAGGGCAGG No data
1007553393_1007553405 16 Left 1007553393 6:42746726-42746748 CCTATCCACTGCAGTTCGGCGCG No data
Right 1007553405 6:42746765-42746787 ATCCCCGCAGGCAGTTACTAGGG No data
1007553393_1007553400 -7 Left 1007553393 6:42746726-42746748 CCTATCCACTGCAGTTCGGCGCG No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553393_1007553402 4 Left 1007553393 6:42746726-42746748 CCTATCCACTGCAGTTCGGCGCG No data
Right 1007553402 6:42746753-42746775 GGGGGCTCCTGGATCCCCGCAGG No data
1007553393_1007553404 15 Left 1007553393 6:42746726-42746748 CCTATCCACTGCAGTTCGGCGCG No data
Right 1007553404 6:42746764-42746786 GATCCCCGCAGGCAGTTACTAGG No data
1007553393_1007553410 26 Left 1007553393 6:42746726-42746748 CCTATCCACTGCAGTTCGGCGCG No data
Right 1007553410 6:42746775-42746797 GCAGTTACTAGGGCAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007553393 Original CRISPR CGCGCCGAACTGCAGTGGAT AGG (reversed) Intergenic
No off target data available for this crispr