ID: 1007553399

View in Genome Browser
Species Human (GRCh38)
Location 6:42746735-42746757
Sequence TGCAGTTCGGCGCGGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007553383_1007553399 -3 Left 1007553383 6:42746715-42746737 CCCCCCTCCCCCCTATCCACTGC No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data
1007553388_1007553399 -10 Left 1007553388 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data
1007553375_1007553399 23 Left 1007553375 6:42746689-42746711 CCTCCCCGTAGCCCTCATCCTTA No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data
1007553377_1007553399 19 Left 1007553377 6:42746693-42746715 CCCGTAGCCCTCATCCTTACCGC No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data
1007553386_1007553399 -6 Left 1007553386 6:42746718-42746740 CCCTCCCCCCTATCCACTGCAGT No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data
1007553379_1007553399 12 Left 1007553379 6:42746700-42746722 CCCTCATCCTTACCGCCCCCCTC No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data
1007553384_1007553399 -4 Left 1007553384 6:42746716-42746738 CCCCCTCCCCCCTATCCACTGCA No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data
1007553382_1007553399 0 Left 1007553382 6:42746712-42746734 CCGCCCCCCTCCCCCCTATCCAC No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data
1007553385_1007553399 -5 Left 1007553385 6:42746717-42746739 CCCCTCCCCCCTATCCACTGCAG No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data
1007553387_1007553399 -7 Left 1007553387 6:42746719-42746741 CCTCCCCCCTATCCACTGCAGTT No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data
1007553378_1007553399 18 Left 1007553378 6:42746694-42746716 CCGTAGCCCTCATCCTTACCGCC No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data
1007553376_1007553399 20 Left 1007553376 6:42746692-42746714 CCCCGTAGCCCTCATCCTTACCG No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data
1007553381_1007553399 5 Left 1007553381 6:42746707-42746729 CCTTACCGCCCCCCTCCCCCCTA No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data
1007553380_1007553399 11 Left 1007553380 6:42746701-42746723 CCTCATCCTTACCGCCCCCCTCC No data
Right 1007553399 6:42746735-42746757 TGCAGTTCGGCGCGGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007553399 Original CRISPR TGCAGTTCGGCGCGGCCTGG GGG Intergenic
No off target data available for this crispr