ID: 1007553400

View in Genome Browser
Species Human (GRCh38)
Location 6:42746742-42746764
Sequence CGGCGCGGCCTGGGGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007553388_1007553400 -3 Left 1007553388 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553380_1007553400 18 Left 1007553380 6:42746701-42746723 CCTCATCCTTACCGCCCCCCTCC No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553392_1007553400 -6 Left 1007553392 6:42746725-42746747 CCCTATCCACTGCAGTTCGGCGC No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553384_1007553400 3 Left 1007553384 6:42746716-42746738 CCCCCTCCCCCCTATCCACTGCA No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553387_1007553400 0 Left 1007553387 6:42746719-42746741 CCTCCCCCCTATCCACTGCAGTT No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553376_1007553400 27 Left 1007553376 6:42746692-42746714 CCCCGTAGCCCTCATCCTTACCG No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553377_1007553400 26 Left 1007553377 6:42746693-42746715 CCCGTAGCCCTCATCCTTACCGC No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553386_1007553400 1 Left 1007553386 6:42746718-42746740 CCCTCCCCCCTATCCACTGCAGT No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553378_1007553400 25 Left 1007553378 6:42746694-42746716 CCGTAGCCCTCATCCTTACCGCC No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553379_1007553400 19 Left 1007553379 6:42746700-42746722 CCCTCATCCTTACCGCCCCCCTC No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553391_1007553400 -5 Left 1007553391 6:42746724-42746746 CCCCTATCCACTGCAGTTCGGCG No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553383_1007553400 4 Left 1007553383 6:42746715-42746737 CCCCCCTCCCCCCTATCCACTGC No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553375_1007553400 30 Left 1007553375 6:42746689-42746711 CCTCCCCGTAGCCCTCATCCTTA No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553390_1007553400 -4 Left 1007553390 6:42746723-42746745 CCCCCTATCCACTGCAGTTCGGC No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553393_1007553400 -7 Left 1007553393 6:42746726-42746748 CCTATCCACTGCAGTTCGGCGCG No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553381_1007553400 12 Left 1007553381 6:42746707-42746729 CCTTACCGCCCCCCTCCCCCCTA No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553385_1007553400 2 Left 1007553385 6:42746717-42746739 CCCCTCCCCCCTATCCACTGCAG No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data
1007553382_1007553400 7 Left 1007553382 6:42746712-42746734 CCGCCCCCCTCCCCCCTATCCAC No data
Right 1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007553400 Original CRISPR CGGCGCGGCCTGGGGGCTCC TGG Intergenic
No off target data available for this crispr