ID: 1007553405

View in Genome Browser
Species Human (GRCh38)
Location 6:42746765-42746787
Sequence ATCCCCGCAGGCAGTTACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007553392_1007553405 17 Left 1007553392 6:42746725-42746747 CCCTATCCACTGCAGTTCGGCGC No data
Right 1007553405 6:42746765-42746787 ATCCCCGCAGGCAGTTACTAGGG No data
1007553390_1007553405 19 Left 1007553390 6:42746723-42746745 CCCCCTATCCACTGCAGTTCGGC No data
Right 1007553405 6:42746765-42746787 ATCCCCGCAGGCAGTTACTAGGG No data
1007553386_1007553405 24 Left 1007553386 6:42746718-42746740 CCCTCCCCCCTATCCACTGCAGT No data
Right 1007553405 6:42746765-42746787 ATCCCCGCAGGCAGTTACTAGGG No data
1007553395_1007553405 11 Left 1007553395 6:42746731-42746753 CCACTGCAGTTCGGCGCGGCCTG No data
Right 1007553405 6:42746765-42746787 ATCCCCGCAGGCAGTTACTAGGG No data
1007553391_1007553405 18 Left 1007553391 6:42746724-42746746 CCCCTATCCACTGCAGTTCGGCG No data
Right 1007553405 6:42746765-42746787 ATCCCCGCAGGCAGTTACTAGGG No data
1007553388_1007553405 20 Left 1007553388 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
Right 1007553405 6:42746765-42746787 ATCCCCGCAGGCAGTTACTAGGG No data
1007553387_1007553405 23 Left 1007553387 6:42746719-42746741 CCTCCCCCCTATCCACTGCAGTT No data
Right 1007553405 6:42746765-42746787 ATCCCCGCAGGCAGTTACTAGGG No data
1007553401_1007553405 -8 Left 1007553401 6:42746750-42746772 CCTGGGGGCTCCTGGATCCCCGC No data
Right 1007553405 6:42746765-42746787 ATCCCCGCAGGCAGTTACTAGGG No data
1007553384_1007553405 26 Left 1007553384 6:42746716-42746738 CCCCCTCCCCCCTATCCACTGCA No data
Right 1007553405 6:42746765-42746787 ATCCCCGCAGGCAGTTACTAGGG No data
1007553393_1007553405 16 Left 1007553393 6:42746726-42746748 CCTATCCACTGCAGTTCGGCGCG No data
Right 1007553405 6:42746765-42746787 ATCCCCGCAGGCAGTTACTAGGG No data
1007553383_1007553405 27 Left 1007553383 6:42746715-42746737 CCCCCCTCCCCCCTATCCACTGC No data
Right 1007553405 6:42746765-42746787 ATCCCCGCAGGCAGTTACTAGGG No data
1007553385_1007553405 25 Left 1007553385 6:42746717-42746739 CCCCTCCCCCCTATCCACTGCAG No data
Right 1007553405 6:42746765-42746787 ATCCCCGCAGGCAGTTACTAGGG No data
1007553382_1007553405 30 Left 1007553382 6:42746712-42746734 CCGCCCCCCTCCCCCCTATCCAC No data
Right 1007553405 6:42746765-42746787 ATCCCCGCAGGCAGTTACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007553405 Original CRISPR ATCCCCGCAGGCAGTTACTA GGG Intergenic
No off target data available for this crispr