ID: 1007553410

View in Genome Browser
Species Human (GRCh38)
Location 6:42746775-42746797
Sequence GCAGTTACTAGGGCAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007553395_1007553410 21 Left 1007553395 6:42746731-42746753 CCACTGCAGTTCGGCGCGGCCTG No data
Right 1007553410 6:42746775-42746797 GCAGTTACTAGGGCAGGAGAAGG No data
1007553393_1007553410 26 Left 1007553393 6:42746726-42746748 CCTATCCACTGCAGTTCGGCGCG No data
Right 1007553410 6:42746775-42746797 GCAGTTACTAGGGCAGGAGAAGG No data
1007553391_1007553410 28 Left 1007553391 6:42746724-42746746 CCCCTATCCACTGCAGTTCGGCG No data
Right 1007553410 6:42746775-42746797 GCAGTTACTAGGGCAGGAGAAGG No data
1007553401_1007553410 2 Left 1007553401 6:42746750-42746772 CCTGGGGGCTCCTGGATCCCCGC No data
Right 1007553410 6:42746775-42746797 GCAGTTACTAGGGCAGGAGAAGG No data
1007553388_1007553410 30 Left 1007553388 6:42746722-42746744 CCCCCCTATCCACTGCAGTTCGG No data
Right 1007553410 6:42746775-42746797 GCAGTTACTAGGGCAGGAGAAGG No data
1007553392_1007553410 27 Left 1007553392 6:42746725-42746747 CCCTATCCACTGCAGTTCGGCGC No data
Right 1007553410 6:42746775-42746797 GCAGTTACTAGGGCAGGAGAAGG No data
1007553403_1007553410 -8 Left 1007553403 6:42746760-42746782 CCTGGATCCCCGCAGGCAGTTAC No data
Right 1007553410 6:42746775-42746797 GCAGTTACTAGGGCAGGAGAAGG No data
1007553390_1007553410 29 Left 1007553390 6:42746723-42746745 CCCCCTATCCACTGCAGTTCGGC No data
Right 1007553410 6:42746775-42746797 GCAGTTACTAGGGCAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007553410 Original CRISPR GCAGTTACTAGGGCAGGAGA AGG Intergenic
No off target data available for this crispr