ID: 1007553484

View in Genome Browser
Species Human (GRCh38)
Location 6:42747037-42747059
Sequence CCCGGGCTCCGTGGCTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007553468_1007553484 23 Left 1007553468 6:42746991-42747013 CCTCCGCAGCTGGGCGTCGCCGG 0: 1
1: 0
2: 0
3: 26
4: 105
Right 1007553484 6:42747037-42747059 CCCGGGCTCCGTGGCTCTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 171
1007553466_1007553484 29 Left 1007553466 6:42746985-42747007 CCACTCCCTCCGCAGCTGGGCGT 0: 1
1: 0
2: 1
3: 34
4: 202
Right 1007553484 6:42747037-42747059 CCCGGGCTCCGTGGCTCTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 171
1007553467_1007553484 24 Left 1007553467 6:42746990-42747012 CCCTCCGCAGCTGGGCGTCGCCG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1007553484 6:42747037-42747059 CCCGGGCTCCGTGGCTCTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 171
1007553475_1007553484 0 Left 1007553475 6:42747014-42747036 CCGCGCTGGGGTGAGACCCTAGC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1007553484 6:42747037-42747059 CCCGGGCTCCGTGGCTCTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 171
1007553470_1007553484 20 Left 1007553470 6:42746994-42747016 CCGCAGCTGGGCGTCGCCGGCCG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1007553484 6:42747037-42747059 CCCGGGCTCCGTGGCTCTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 171
1007553474_1007553484 4 Left 1007553474 6:42747010-42747032 CCGGCCGCGCTGGGGTGAGACCC 0: 1
1: 0
2: 2
3: 11
4: 123
Right 1007553484 6:42747037-42747059 CCCGGGCTCCGTGGCTCTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007553484 Original CRISPR CCCGGGCTCCGTGGCTCTCT GGG Intronic