ID: 1007556204

View in Genome Browser
Species Human (GRCh38)
Location 6:42768661-42768683
Sequence CACTGGGCATGGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 763
Summary {0: 1, 1: 1, 2: 7, 3: 94, 4: 660}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007556204_1007556211 13 Left 1007556204 6:42768661-42768683 CCTTCTCCCCTCCATGCCCAGTG 0: 1
1: 1
2: 7
3: 94
4: 660
Right 1007556211 6:42768697-42768719 TTCCCCTCTACCCCAATCACTGG 0: 1
1: 0
2: 0
3: 26
4: 250
1007556204_1007556217 24 Left 1007556204 6:42768661-42768683 CCTTCTCCCCTCCATGCCCAGTG 0: 1
1: 1
2: 7
3: 94
4: 660
Right 1007556217 6:42768708-42768730 CCCAATCACTGGTCCTTCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007556204 Original CRISPR CACTGGGCATGGAGGGGAGA AGG (reversed) Intronic
900131809 1:1090421-1090443 AGCTGGGCCTGGAGGGGACACGG + Exonic
900966837 1:5964656-5964678 CACTGGCCAGGGAGTGGAGAAGG - Intronic
901147224 1:7073453-7073475 GACTGGGGAGGGAGTGGAGATGG + Intronic
901301419 1:8202330-8202352 CACTGCGCATGGAGGCGGGGTGG - Intergenic
901674162 1:10873221-10873243 CACTGGGTCTGGAGGGGATCAGG + Intergenic
901896604 1:12318546-12318568 CACTAGGCAGGCAGGGGACAGGG - Intronic
902379496 1:16045970-16045992 CCCAGGGCATGGAGGAGGGAAGG - Intronic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903571801 1:24311364-24311386 CACTGGAGAGGGTGGGGAGAGGG - Intergenic
903790584 1:25890278-25890300 CACTGGGCAATCAGGGAAGAGGG - Intronic
903948385 1:26978914-26978936 CACTGAGCAGGTAGGAGAGATGG + Intergenic
904234047 1:29102332-29102354 TACTGTTTATGGAGGGGAGAAGG + Intronic
904753805 1:32756995-32757017 GACTGAGCATGGAGGTGGGAGGG + Intronic
904795762 1:33055268-33055290 CCTATGGCATGGAGGGGAGATGG + Intronic
905272916 1:36798506-36798528 CAGTGGGCATGGAGCTGAGCTGG - Exonic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906155050 1:43609180-43609202 CACAGGGCAGGGAGGGGGTAGGG - Intronic
906190153 1:43893667-43893689 ATCTGGGCCTGGAGAGGAGATGG - Intronic
906204648 1:43980251-43980273 CACTGGGCATGGCAGGAAGGGGG - Intronic
906461935 1:46041209-46041231 CACTGGGCCTGGTGTGTAGAGGG - Exonic
906669620 1:47645102-47645124 CACTGGCCATGAGGGAGAGAAGG + Intergenic
906684964 1:47757374-47757396 GGCTGGGCTTGGAGGGGAGGAGG - Intergenic
907051319 1:51331233-51331255 CACTGGGAATGCAGGGGAGAGGG - Intronic
907121596 1:52012798-52012820 CATTGGGGATGGGGGTGAGAAGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907355436 1:53869078-53869100 AAGTGGGCATGGAAGGTAGAGGG + Intronic
907607174 1:55829650-55829672 CACTGGGAATGTTGGTGAGAGGG + Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
909267323 1:73577253-73577275 TCCTGGGCATGAAGTGGAGATGG - Intergenic
909267363 1:73577479-73577501 ACCTGGGCATGGAGCAGAGAGGG - Intergenic
909419770 1:75450719-75450741 GCCTGGGCATGGGGTGGAGAGGG - Intronic
909732724 1:78914821-78914843 CTCTGCGCTTGGAGGGTAGAAGG + Intronic
911380101 1:97104035-97104057 CACTGGGCAGGGAGGGTAATCGG - Intronic
912040433 1:105383376-105383398 GCCTGGGCATGGAGTAGAGAGGG + Intergenic
912106024 1:106276677-106276699 CAAGGGGCATGGATGGGAGGTGG - Intergenic
912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG + Intronic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912860760 1:113211768-113211790 CAGAGGACAGGGAGGGGAGATGG + Intergenic
912936973 1:114012201-114012223 GACTGGACATGGAGTAGAGAAGG - Intergenic
915444616 1:155967616-155967638 CCCTGGGCCTGGAAGGGAGAAGG - Intronic
915915567 1:159938416-159938438 CCCGGGGCATGGAGAGGATAGGG - Intronic
915931234 1:160062152-160062174 CTCTGGGCAGGCTGGGGAGATGG - Intronic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916660964 1:166921826-166921848 TACTGGGGCAGGAGGGGAGAAGG + Intronic
917042580 1:170822442-170822464 CACTAGAGATGGAGGGGAGATGG - Intergenic
917732734 1:177892078-177892100 GCCTGGGCATGGAGCAGAGAGGG - Intergenic
918038496 1:180897697-180897719 AAAGGGGCATGGAGGGGTGAAGG - Intergenic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
918581462 1:186135766-186135788 CACTGGAAATGGAGGGGAAAAGG - Intronic
919045528 1:192446848-192446870 CACTGGGCCTGTTGGGGAGTGGG + Intergenic
919666836 1:200300596-200300618 CAGTGTGCATGGATGGGACAGGG - Intergenic
919982483 1:202650962-202650984 CACTGGGCAGAGTGGGAAGAAGG + Intronic
920404847 1:205701481-205701503 CACTGGGCATGGCCAGGACATGG - Intergenic
920500050 1:206480180-206480202 GAGTGGGCAGGAAGGGGAGATGG + Intronic
920525617 1:206663892-206663914 CACTGGGCACGGAGGGGAGCCGG + Intronic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
922095441 1:222439461-222439483 CACTGGGAATGGGGGGACGAGGG - Intergenic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
922688113 1:227663892-227663914 CACTGGGCTTGGGTGGGAGTGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924258473 1:242205770-242205792 CACTGAGCAGGGATGGCAGATGG + Intronic
924934201 1:248754814-248754836 CACCGGGCCTGGAGGGGTGAGGG - Intronic
1063179466 10:3584762-3584784 GACGGGGGCTGGAGGGGAGAAGG - Intergenic
1065645727 10:27831879-27831901 CATATGGCATGCAGGGGAGAGGG - Intronic
1065818117 10:29500329-29500351 CACTGGGCTGGGTGGGGAGCGGG + Intronic
1065954803 10:30684176-30684198 CACTGGGCTGGGTGGGGAGCGGG - Intergenic
1066189678 10:33044909-33044931 GACAGGGTATGGAGGGGAGATGG + Intergenic
1066961606 10:42231615-42231637 CACAGGGCATGGATAGGACAGGG - Intergenic
1067015403 10:42754073-42754095 AACTGGGCCTGGAGGGGTGCTGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067278478 10:44854104-44854126 CAGTGGGCATGCAGAGGAGGTGG - Intergenic
1067429912 10:46236236-46236258 GACGGGGCCTAGAGGGGAGAAGG - Intergenic
1067568696 10:47356083-47356105 CACTGGGCAGGGAAGATAGATGG - Intronic
1068045505 10:51881160-51881182 TAGTGCGCATGAAGGGGAGAGGG + Intronic
1069757318 10:70781334-70781356 CAGTGGGGAGGGATGGGAGATGG - Intronic
1070414576 10:76177746-76177768 CAATGAGGATTGAGGGGAGAGGG + Intronic
1070529616 10:77325318-77325340 CACTGGGCGTCGAGGAGAGCAGG + Intronic
1070597784 10:77844858-77844880 CACTGGGCAGAGAGGGGGGCAGG + Intronic
1070646571 10:78205971-78205993 AGCTGGGCAGGGAGAGGAGATGG - Intergenic
1070704061 10:78624819-78624841 CACTGGGCTTGGGAAGGAGATGG - Intergenic
1070758413 10:79007834-79007856 CCCTGGGCATGGAGTGGAATAGG + Intergenic
1070795835 10:79215775-79215797 CCCAGGGCATGGAAGGGAGATGG + Intronic
1070813983 10:79312003-79312025 CACTGGGCAAGGACCTGAGATGG - Intronic
1070931452 10:80263972-80263994 CTCTGGGAATGGAGGGGAAGAGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073445651 10:103578838-103578860 CACGGGGCATGGGAGGGAGCCGG - Intronic
1074144074 10:110701194-110701216 CACTGGGAACGGAGTTGAGAAGG - Intronic
1075072326 10:119327371-119327393 CCCAGGGCACAGAGGGGAGAAGG - Intronic
1075380449 10:122014552-122014574 CACTGAGCATGGGGTGGAGAGGG - Intronic
1075729384 10:124627279-124627301 CCCGGGGCATGGAGGGCACAGGG - Intronic
1076023024 10:127089678-127089700 CCCTGGGCAGGGCGTGGAGATGG + Intronic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076460989 10:130647364-130647386 CCCTGGGCAGCGAGGGCAGAGGG - Intergenic
1076616224 10:131756645-131756667 CCCTGGGCATGGTGGGGAAGTGG - Intergenic
1076891858 10:133288615-133288637 CCCTGGGCAAGGAGGGGAGCTGG + Intronic
1076907173 10:133368547-133368569 CACTGGCCATGGAGGTCACATGG - Intronic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077287267 11:1773121-1773143 CACAGGTCAGGGAGGGGAAAGGG + Intergenic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077581275 11:3418802-3418824 CACTTGGAACGGAGGGCAGAGGG + Intergenic
1078186453 11:9055732-9055754 GGCTGGGCCTGGAGGGGAGCAGG - Intronic
1078464463 11:11539985-11540007 CAATGGGAAATGAGGGGAGACGG + Intronic
1078605981 11:12776007-12776029 CAGTGGGCAGGGAGGGGTGCAGG + Intronic
1078989596 11:16633018-16633040 GCCTGGGCATGAAGTGGAGAGGG + Intronic
1079565262 11:21875122-21875144 GACTGGGAATGAAGGTGAGAAGG - Intergenic
1079614811 11:22479206-22479228 CACTCAGTATGGAGGGTAGAAGG + Intergenic
1080041522 11:27764205-27764227 CTCTGGACATGGAGGGAATAAGG - Intergenic
1080764462 11:35282503-35282525 CACTGGGCATGGTGGGGGTGGGG - Intronic
1081510910 11:43772419-43772441 CACTGTGCATGAAGGGGTGATGG - Intronic
1081729341 11:45358156-45358178 CATTTGGGATGGAGGGCAGAGGG + Intergenic
1082057771 11:47834035-47834057 TACTGGACATGGAGGTGAGGTGG + Intronic
1082948702 11:58788197-58788219 GCCTGGGCAAGGAGTGGAGAGGG - Intergenic
1083058884 11:59848948-59848970 CACTGGCCAGGGAATGGAGAAGG - Intergenic
1083252118 11:61475192-61475214 AGCGGGGCATGGAGGGGAGTCGG - Intronic
1083335600 11:61920006-61920028 CCTGGGGCATGGAGGGGAGGGGG - Intronic
1083687527 11:64385478-64385500 CACTGGACACAGAGGGGAGGTGG + Intergenic
1083698872 11:64461101-64461123 CACTGGGAATGGTGGGGAGGTGG + Intergenic
1083764468 11:64835412-64835434 CACTCGGCCTGGGGAGGAGAAGG + Exonic
1084112891 11:67024869-67024891 CACTGGGCAAGGAGGTGGGGTGG + Intronic
1084238197 11:67801640-67801662 CACTTGGAAAGGAGGGCAGAGGG + Intergenic
1084466822 11:69328177-69328199 CACTGGGCAGGATGGGGACAGGG - Intronic
1084467495 11:69334561-69334583 CACTGAGCTTGGAGAGGGGAAGG - Intronic
1084834213 11:71791194-71791216 CACTTGGAAAGGAGGGCAGAGGG - Intronic
1084955874 11:72691325-72691347 CCCTGGGCATGGAAGGAAGGAGG - Intronic
1084961060 11:72716970-72716992 CTCAGGTCATGTAGGGGAGACGG - Intronic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085074455 11:73577855-73577877 CACTGGGCATGAGGGAGGGAAGG + Intronic
1085447622 11:76611095-76611117 CTCCGGCCATGGAGAGGAGAGGG + Intergenic
1085505385 11:77055959-77055981 CCCTGGGGATGGTGGGGAGGTGG + Intergenic
1085512060 11:77093448-77093470 CTCTGGCCAGGAAGGGGAGAGGG + Intronic
1086329600 11:85740348-85740370 GACTGGGCATGAAGAGGATAGGG - Intronic
1087562076 11:99802960-99802982 GCCTAGGCATGGAGTGGAGAGGG + Intronic
1087645154 11:100800331-100800353 CACTGGGAACAGAGGGGAGTTGG + Intronic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1088949405 11:114551655-114551677 AACTGGGCAGGGAGGTGGGATGG + Intronic
1089127855 11:116190029-116190051 AGCTGGGGGTGGAGGGGAGAGGG + Intergenic
1089278417 11:117355501-117355523 CACTGGCCCTGGAGGGGACAAGG + Intronic
1089381404 11:118035398-118035420 CACTGGGCATAGAGTGGTCAAGG + Intergenic
1089566896 11:119376423-119376445 CACTGGGCAGGGAGGGGTATGGG - Intronic
1089573174 11:119423199-119423221 CACCGGGGATGGAGGAGAGGGGG + Exonic
1089592856 11:119555767-119555789 CACTCAGCATGGAGCGGGGAGGG + Intergenic
1089905437 11:122033193-122033215 CATTGGGCATGTACAGGAGAGGG + Intergenic
1090238224 11:125164915-125164937 GACAGGGCAAGGAGGAGAGAGGG + Intronic
1090352154 11:126114580-126114602 AGCTGGGCATGCAGGGGAAAAGG + Intergenic
1090582040 11:128171075-128171097 AATTTGGCATGGAGGGGTGATGG + Intergenic
1090619403 11:128548283-128548305 CACCAGGCATGGCGTGGAGAAGG - Intronic
1091078254 11:132641326-132641348 CTCTGGGCAAGGAGAGGAGGTGG - Intronic
1091594263 12:1865123-1865145 ACCTGGCCACGGAGGGGAGAAGG + Intronic
1091721507 12:2817333-2817355 CCCTGGGCCTGGAGGGGGGAAGG + Intronic
1091777052 12:3191408-3191430 CACTGGACAGGCAGGGGGGAAGG - Intronic
1091865288 12:3829112-3829134 GACAGGGAATGGAGGGGCGAGGG + Intronic
1092121303 12:6045902-6045924 GACCAGGCATGGAAGGGAGAAGG - Intronic
1092870043 12:12798134-12798156 AACTGGCCATGCTGGGGAGATGG - Intronic
1093809338 12:23472978-23473000 GCCTGGGCATGGAGCAGAGAGGG - Intergenic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094454476 12:30617002-30617024 CACTGGGCAAGCAGGGGAGGGGG - Intergenic
1096357403 12:50952837-50952859 CACTGGGCTTGGAGGGGAAGGGG - Intergenic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096615635 12:52831699-52831721 CCCTGGCCTTGGAGGGGAGGTGG - Intronic
1097154941 12:57006015-57006037 CACTGGGCAGCCAGAGGAGAGGG + Intronic
1097737136 12:63194772-63194794 AAGTGGCCAGGGAGGGGAGATGG - Intergenic
1097825500 12:64171405-64171427 CACTGGGGATGGAGAGCTGATGG + Intergenic
1098381911 12:69878895-69878917 TGCTGGGCATGGGGGGGTGAGGG - Intronic
1098872867 12:75836234-75836256 CACTGTGCCTGGTGTGGAGAGGG - Intergenic
1100931904 12:99619226-99619248 GCCTGGGCATGGTGTGGAGAGGG - Intronic
1102050099 12:109855966-109855988 CACCAGGCCTGGAGGAGAGAAGG - Intronic
1102240959 12:111324418-111324440 CACTGGGCAGGGAGGGGGCCAGG + Intronic
1102259926 12:111437487-111437509 CACTGGGCATTCAGGGCAGCAGG + Intronic
1102273456 12:111560602-111560624 CACTGTACAGGGAGGGAAGAAGG + Intronic
1102565408 12:113794378-113794400 CACTGTGCATGGAGAGGAGGAGG - Intergenic
1102858968 12:116319022-116319044 AACAGGGCATGGGGGAGAGAGGG + Intergenic
1102943101 12:116961358-116961380 CACTGGGCTGGGAGGTGAGGAGG + Intronic
1103243965 12:119439348-119439370 CCCTAGACCTGGAGGGGAGAAGG + Intronic
1104715919 12:131016114-131016136 CAGAGGGCTTGGAGGAGAGAAGG - Intronic
1106568236 13:30905560-30905582 TACTGGGGAGGCAGGGGAGAAGG + Intergenic
1106592441 13:31109488-31109510 TGCTGTGCATGGAAGGGAGAGGG - Intergenic
1107097263 13:36550095-36550117 CACTGAGCCTGGGTGGGAGAAGG + Intergenic
1107131852 13:36905020-36905042 CACTGAGCACTGAGGGAAGACGG + Intronic
1109646443 13:65264428-65264450 CCCTGGGCATGGAGCAGAAAGGG - Intergenic
1109808441 13:67475343-67475365 CTCTTGGCATGGAGCAGAGAAGG + Intergenic
1110638233 13:77790998-77791020 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
1110642669 13:77843523-77843545 CACTGGGCAGGGAGGTTAGTAGG - Intergenic
1110950771 13:81487601-81487623 CATTGTCCATGAAGGGGAGAAGG - Intergenic
1110999080 13:82154788-82154810 GCCTGGGCATGCTGGGGAGATGG + Intergenic
1111041626 13:82756873-82756895 CCCTGAGCATGGAGCAGAGAGGG - Intergenic
1112223470 13:97514514-97514536 GCCTGGGAATGGAGCGGAGAAGG + Intergenic
1113294069 13:108938621-108938643 GCCTGGGCATGGAGCAGAGAGGG + Intronic
1113552813 13:111206253-111206275 CACTGCACATTGAGGAGAGACGG + Intronic
1113606278 13:111609846-111609868 CACTGGGCACAGAGGGCAGCAGG - Intronic
1113902534 13:113804865-113804887 CACCTGCCATGGAGAGGAGACGG - Exonic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114640579 14:24217019-24217041 TACTGGGCATCCAGGGGAGGGGG + Exonic
1115731180 14:36271503-36271525 CACTGGGGCTTGAGGGGAGGGGG + Intergenic
1116385844 14:44328847-44328869 CAGGGGACTTGGAGGGGAGAGGG - Intergenic
1117457441 14:55912279-55912301 CAGAGGGCATGGTGGGGAGGGGG + Intergenic
1117824441 14:59687317-59687339 GCCTAGGCATGGAGTGGAGAGGG - Intronic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118678160 14:68211210-68211232 CACTGGGTGGGGAGGGGAAAGGG - Intronic
1119461643 14:74809705-74809727 CACTGGGCCAGGAGGGGGAATGG - Exonic
1120121038 14:80680406-80680428 TCCTGGGCATGGAGCGCAGAGGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120279405 14:82420074-82420096 GCCTGGGCATGGAGCAGAGAGGG + Intergenic
1121111195 14:91314217-91314239 CACTGGGGATGGGAGAGAGAAGG + Intronic
1121407170 14:93726109-93726131 CCCTGGGCTTGGAGGGCAGCAGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121638186 14:95467741-95467763 CAGTGGGCAAGGAGGGTAAATGG + Intronic
1122328137 14:100894957-100894979 CACCTGGCTTGGAGGGGTGAGGG + Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122659157 14:103282828-103282850 CACTGGGGATGGAGGATGGAGGG + Intergenic
1124036027 15:26054352-26054374 CACTGGCCATGGGGGGGAGGGGG - Intergenic
1124372620 15:29112056-29112078 CACTGGGCATGGTGGGGATGGGG - Intronic
1124815634 15:32989252-32989274 CACTGGGGATGGAAGGTAGGTGG + Intronic
1124825046 15:33085334-33085356 CACTGTCCAAAGAGGGGAGAAGG + Intronic
1124955781 15:34359505-34359527 CACTGGGCTGGGAGGGAACAAGG - Intronic
1125383852 15:39115458-39115480 GCCTGAGCATGGAGTGGAGAGGG - Intergenic
1125927252 15:43573060-43573082 CACTGAGCAGGGAGTGGACATGG + Exonic
1125940395 15:43672625-43672647 CACTGAGCAGGGAGTGGACATGG + Intergenic
1126344059 15:47674579-47674601 CACTGTGCTTGGAAGGGTGAGGG + Intronic
1127141777 15:55985341-55985363 CACGGGGCACTGAGGGGAGGAGG + Intronic
1128094644 15:64944489-64944511 TTCTGGGCATGAAGGGGATATGG - Intronic
1128393981 15:67204793-67204815 TAGTGGGCCTGGAGTGGAGAAGG - Intronic
1128518307 15:68358099-68358121 TACAGGTCATGGAGGGAAGATGG - Intronic
1129164921 15:73771480-73771502 CACTGGGCTGGGAGATGAGATGG - Intergenic
1129615996 15:77099018-77099040 CCCTGGGCATGGATGAGAAAGGG + Intergenic
1130048898 15:80467258-80467280 CAGTCGGCATGGACTGGAGAAGG + Intronic
1130715479 15:86329536-86329558 GCCTGGGCATGAAGTGGAGAGGG - Intronic
1130900401 15:88202670-88202692 CACAGGTCATGGTGAGGAGATGG - Intronic
1131369157 15:91865367-91865389 ACATGGGCTTGGAGGGGAGAGGG + Intronic
1131786229 15:95914003-95914025 CACTGTGTAGGGAGGGGGGATGG + Intergenic
1132008437 15:98252559-98252581 CAGTGGGCTTGGAGGTGTGAAGG - Intergenic
1132615880 16:840879-840901 CACTGGGCGTGGAGGGTCGCGGG + Intergenic
1132879750 16:2156855-2156877 CACTGGGGAAGCAGGAGAGAGGG + Intronic
1132924880 16:2424140-2424162 CACCGGGGGTGGAAGGGAGAAGG - Intergenic
1133349843 16:5094087-5094109 CACTTGGAAAGGAGGGCAGAGGG + Intronic
1133833546 16:9346532-9346554 GACTGGGGATGGAGTGGGGATGG - Intergenic
1133908608 16:10044176-10044198 AGCTGGGCATGGTGGCGAGACGG - Intronic
1134030771 16:10990605-10990627 CAGTGGGCAGGGATGGGAGCAGG + Intronic
1134073275 16:11273614-11273636 CTCTGGGCAAGGAGGTGAGGCGG + Intronic
1134264786 16:12683709-12683731 CACTGAGGATGGAGAGGAGATGG - Intronic
1134411882 16:14010060-14010082 CACTCTGCTTGGTGGGGAGAAGG + Intergenic
1134602040 16:15541221-15541243 CATTGGGCAAGGTGTGGAGAGGG + Intronic
1135429042 16:22366633-22366655 TATTGGGCAGGGAGGGGAGGGGG + Intronic
1135463285 16:22663530-22663552 CACTGGGCTAGTCGGGGAGAAGG + Intergenic
1135633581 16:24055356-24055378 CACTAGGGAAGGAAGGGAGATGG + Intronic
1135875550 16:26196666-26196688 CAGTGGGCAGGGTGGGTAGAGGG + Intergenic
1136184219 16:28576245-28576267 CACTGGGCGGGGAGGGTAGGAGG + Intronic
1136500061 16:30665541-30665563 CACTGGGCAGGGAGGGATCATGG - Intronic
1138562105 16:57807416-57807438 CAGTGGGCATGGAGAGGTGGTGG + Intronic
1139342642 16:66278463-66278485 GCCTTGGCATGGAGGGGAGAAGG - Intergenic
1139596252 16:67960042-67960064 CACAGGGTAAGGATGGGAGAGGG - Intronic
1140899876 16:79357791-79357813 CACTGGGCAGGGAGGAGAATGGG - Intergenic
1140985684 16:80156287-80156309 CACTGGGCAAAGAAGGAAGAAGG + Intergenic
1141009386 16:80383241-80383263 CACTGGGCCTGAATGAGAGAGGG - Intergenic
1141210307 16:81973517-81973539 GCCTGGGCATGGAGCGGAGAGGG - Intergenic
1141259498 16:82439929-82439951 CACAGGGGATGGAAGAGAGAAGG - Intergenic
1142149094 16:88504897-88504919 CACTGGGCCTGCAGGTGCGAGGG + Intronic
1142176449 16:88647633-88647655 CACTGGGCAGGGTGGTGGGAGGG - Intronic
1142557508 17:789912-789934 CCCTCTGCCTGGAGGGGAGAAGG - Intronic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1143023159 17:3927017-3927039 CACTCAGCATGCAGGGCAGAGGG - Intronic
1143296638 17:5876269-5876291 CACTGGGGATGGGGAGGAGGGGG + Intronic
1143393578 17:6575104-6575126 CACTGGGGCTGCAGGGCAGATGG + Intergenic
1143643532 17:8214201-8214223 CACGGGGCAAGGAGGTGGGAAGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144077517 17:11732792-11732814 CACAGGGCATGGAGGGGAACAGG - Intronic
1144466702 17:15502934-15502956 CTTTGGGCCTGGAGGGGAGGTGG - Exonic
1144670935 17:17132220-17132242 CACTGGCCAGGGAGGGAAGGAGG - Intronic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145279636 17:21458027-21458049 AAGGGAGCATGGAGGGGAGATGG + Intergenic
1145398242 17:22512455-22512477 AAGGGAGCATGGAGGGGAGATGG - Intergenic
1145905532 17:28514302-28514324 GAATGGGCAGGGAGGGGAGTGGG - Intronic
1146125839 17:30230711-30230733 GGTGGGGCATGGAGGGGAGAAGG + Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147133020 17:38419905-38419927 GACTGGGAAAGGAGGGGAGCCGG - Intergenic
1147644875 17:42027568-42027590 GACTGGGTCAGGAGGGGAGAGGG - Intronic
1148106156 17:45120121-45120143 CACTGGGCCAGGAAGGGAGTGGG - Intronic
1148355338 17:46972002-46972024 CACAGGGCACGTGGGGGAGAGGG + Intronic
1149623115 17:58060803-58060825 CACTGCGGATGGAGGGGGGCGGG + Intergenic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1149914805 17:60599662-60599684 GACTGGGAATGGAGGAGGGAGGG - Intergenic
1149979353 17:61297284-61297306 GGCTGGGGATGGAGGAGAGAAGG + Intronic
1149988707 17:61368232-61368254 CCCTGGGTATGGAGAGGAGCGGG + Intronic
1150250909 17:63704040-63704062 CACTGGGCCTGGAGGGAAAGGGG + Exonic
1150739442 17:67767601-67767623 CAAAAGGCATGGAGAGGAGAGGG - Intergenic
1151210994 17:72543593-72543615 CAGGGGACATGGAAGGGAGAGGG - Intergenic
1151247683 17:72807666-72807688 CAGTGGGCCTGGAGAGGAAATGG + Intronic
1151407645 17:73899825-73899847 TACTGGCCAGAGAGGGGAGAGGG - Intergenic
1151443074 17:74146060-74146082 CCCTGGACACGGAGTGGAGAAGG + Intergenic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152133316 17:78490292-78490314 CACAGGGCATGGTGGGGAGTGGG - Intronic
1152155263 17:78628890-78628912 CACTCAGCATGGAGGGGCGCCGG - Intergenic
1152830339 17:82493455-82493477 CACCGGGCCTGGAGTGGGGAAGG - Intergenic
1152897426 17:82920853-82920875 CCCTGGGCATGGAAGCGAGGAGG - Intronic
1153544806 18:6194616-6194638 CACAGCACATGGAAGGGAGAAGG - Intronic
1154172435 18:12061383-12061405 CACTGTTCATGGCGGGGAGCAGG + Intergenic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155102565 18:22626906-22626928 CCCTGGGCATGGAGGTGGGTAGG - Intergenic
1155380557 18:25217829-25217851 CACAGGGCATTGAGGGGATAGGG + Intronic
1155507696 18:26548707-26548729 CGCAGGGGATGGAGGGGAGGGGG + Intronic
1156073070 18:33237171-33237193 CACTGGGCTTGGAATGAAGATGG - Intronic
1156426554 18:37019788-37019810 GCCTGGGCATGGAGTGTAGAGGG + Intronic
1156426570 18:37019901-37019923 GCCTGGGCATGAAGGAGAGAGGG + Intronic
1156886453 18:42141163-42141185 GCCTGGGCATGGAGTGGAAAGGG - Intergenic
1156886478 18:42141284-42141306 TGCTGTGCATGGAGTGGAGAGGG - Intergenic
1157386221 18:47261492-47261514 CACTGGGCATGGAGGGGTGAAGG - Intergenic
1157449063 18:47772081-47772103 CACTGCACATGGAGGGTGGAAGG + Intergenic
1157557155 18:48620318-48620340 CCCTGACCTTGGAGGGGAGATGG + Intronic
1157681737 18:49612941-49612963 CACTGGGCATTAACGGGAGTGGG + Intergenic
1157940345 18:51921706-51921728 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
1158797336 18:60863124-60863146 CACTGGGCATGCAGTAGAGGTGG + Intergenic
1159018331 18:63121406-63121428 TTCTGGGGATGGAGGAGAGAGGG - Intergenic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1160191093 18:76714476-76714498 CACTGAGCAGGGAGGGGAAGCGG + Intergenic
1160214301 18:76914108-76914130 TTCTGGGCATTGAGGGGAAATGG - Intronic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160947126 19:1648808-1648830 CACTGGGCATGGGGGGGGGGGGG + Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1160978906 19:1807494-1807516 AGCTGGGCTTGGACGGGAGAAGG - Intronic
1161482913 19:4519609-4519631 CACTGGGCTGGGAGGAGGGAGGG + Intergenic
1162207394 19:9065891-9065913 CCATGGGCATTGAGGGGAGCGGG + Intergenic
1162444313 19:10712894-10712916 GGCAGGGCATGGAGGGGACAGGG + Intronic
1163350361 19:16773062-16773084 CAATTGGCAGGGAGGGTAGAGGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163817567 19:19476062-19476084 CTCTGGTCATGGAGGGGACTCGG + Intronic
1164813686 19:31177842-31177864 CACTGCGCAGAGAGGGGAGGCGG + Intergenic
1164855035 19:31514075-31514097 CACGGTGCGTGGGGGGGAGAGGG - Intergenic
1165202310 19:34155136-34155158 GAATGGCCATGGAGGGGAGGTGG + Intergenic
1165773349 19:38390514-38390536 ACCTGGGGAGGGAGGGGAGAGGG + Intronic
1166230776 19:41424898-41424920 CTCTGGGCATGGGGTGGACATGG + Exonic
1166306954 19:41940538-41940560 CTCAGGGCATGGAGGGGAAGGGG + Intergenic
1167498790 19:49834252-49834274 CATTGGGAATGCAGGGGAGGAGG + Intronic
1167560230 19:50222625-50222647 CGCCAGGCATGGAGGGGAGTGGG - Intronic
1168113819 19:54209683-54209705 CACAGAGCCTGGAGGGCAGATGG + Intronic
1168148511 19:54432585-54432607 CATTGGGCATTGAGAGTAGATGG - Intronic
1168479559 19:56707681-56707703 CAATAGCCATGGAGGAGAGAGGG + Intergenic
925214704 2:2084496-2084518 CCCTGGGCTAGGAGTGGAGAGGG + Intronic
925768447 2:7259712-7259734 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
926075003 2:9935424-9935446 CACTGTGGATAAAGGGGAGAGGG + Intergenic
926085774 2:10019577-10019599 CACCTGGCATGGAGATGAGATGG + Intergenic
926172435 2:10560772-10560794 CACTGGGCAGGCAGGAGAGCTGG - Intergenic
926860756 2:17306246-17306268 AACTGGGCACGGAGGGGAGGAGG - Intergenic
926913707 2:17874230-17874252 CAGTGAGCATAGAGGAGAGATGG + Intergenic
927051170 2:19330896-19330918 CACTGGGCAGGGAAGGGATCTGG - Intergenic
927211964 2:20644615-20644637 CACTTGGTATGGAAGGGAAAGGG - Intronic
928035046 2:27815138-27815160 CAATGGGCATTGAGGGCAGTGGG + Intronic
928129247 2:28637761-28637783 GAGTGGGCAAGGAGGTGAGAAGG - Intronic
929044062 2:37773550-37773572 CTCTGGGCAGGGAGGGGCCAAGG - Intergenic
929060993 2:37924779-37924801 AACTCGGAATGGCGGGGAGAAGG + Intronic
929133702 2:38602890-38602912 CTCCGGGCAGGGAGCGGAGACGG - Exonic
929259682 2:39851760-39851782 CACTGTGGGTGCAGGGGAGAGGG - Intergenic
929603787 2:43221346-43221368 AGCTGAGCATGGAGGGGAGGGGG - Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929918546 2:46155794-46155816 CAATGGGGATAGTGGGGAGAAGG - Intronic
930065521 2:47324653-47324675 CCCTGGGCAGTGAGGGGAGGAGG - Intergenic
930210811 2:48635098-48635120 GCCTGGGCATGGAGTGGAGAGGG + Intronic
930555852 2:52894786-52894808 CACTGAGCCTAGAAGGGAGAGGG - Intergenic
930799297 2:55425940-55425962 CCCTGGGCAGGGAGGGGGCATGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932650165 2:73546902-73546924 CACTGGGCATGGGAGAGAGTTGG + Intronic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
932795504 2:74692018-74692040 CACTGGGCCAGGAGGGAAGCTGG + Intergenic
933336745 2:80968119-80968141 GCCTGGGCATGGAGTGGAGATGG - Intergenic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
934040499 2:88124236-88124258 CCCTGGGCATGCAGGGCAGGTGG + Intronic
934653059 2:96103361-96103383 CACTGGCCATGAAAGGCAGAGGG + Intergenic
934766257 2:96881734-96881756 CAGGGGGCAGGGAGGGGGGAGGG + Intronic
934769541 2:96899100-96899122 CCCTGGGCTTGCAGTGGAGATGG + Intronic
934851208 2:97702368-97702390 CAAGGGGCATGGAGGGAAAATGG - Intergenic
935914503 2:107934985-107935007 CACTGAGCCTGAAGGAGAGAAGG + Intergenic
936072218 2:109378732-109378754 CATGGGGCATGGAGTAGAGAAGG - Intronic
936271828 2:111054917-111054939 GACTGTGCATGGAGGAGAAAGGG + Intronic
936558780 2:113518577-113518599 TAGTGGGCATGGAAGGGAGGGGG + Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
939504593 2:143029964-143029986 CACTGGGCATGGAGGACAGGAGG + Intronic
940408453 2:153332703-153332725 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
942241195 2:173964945-173964967 CCCGGGGCCTGGCGGGGAGACGG + Intronic
942335431 2:174879912-174879934 CACAGGGCATGAAGGGAAGATGG + Intronic
943189956 2:184663404-184663426 CACTGTGCATGGGAGGGAGTTGG + Intronic
944607308 2:201363641-201363663 GCCTGAGCATGGAGGAGAGAGGG - Intergenic
944944891 2:204672388-204672410 CACTGGACATGAAGGGCAGATGG + Intronic
945376706 2:209085122-209085144 AACTGGGCAGGGAGTGGGGAAGG - Intergenic
946988000 2:225295518-225295540 TAGTGGGCATGGAGAAGAGATGG - Intergenic
947398694 2:229712466-229712488 TAGTGGGAATGGATGGGAGAAGG - Intronic
947809015 2:232988184-232988206 CACTGGGGGAGGAGGGGAGGTGG + Intronic
947885442 2:233566148-233566170 CACTGGGGAGGGAGGGGGGAAGG + Intronic
948042732 2:234916606-234916628 AACTGGGCAAGGAGGAGAGTGGG + Intergenic
948179171 2:235966255-235966277 CTCTGGGGATGGAGGAGAGGGGG + Intronic
948208141 2:236173522-236173544 CAGAGGGCACGGAGGGGTGAGGG + Intergenic
948326794 2:237128327-237128349 CAGGGGGCATGCAGGGGAAAGGG - Intergenic
948551731 2:238777542-238777564 CACTGAGCATGGAAAGGGGAAGG + Intergenic
948680904 2:239634079-239634101 CACTGGGGAGGCAAGGGAGATGG + Intergenic
948680925 2:239634139-239634161 CACTGGGGAGGCAAGGGAGATGG + Intergenic
948843514 2:240672101-240672123 CCCTGAGCAGGGAGGGGAGGTGG + Intergenic
948863827 2:240765570-240765592 CGCTGGGCAGGTAGGGGAGGGGG - Intronic
948864030 2:240766402-240766424 CACTGGGCAGGCAGGGGAAACGG + Intronic
948921612 2:241068592-241068614 CACTGTGCAGGGATGGGGGACGG - Intronic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1169671344 20:8106161-8106183 TCCTGGGCATGGAGCAGAGAGGG - Intergenic
1170783669 20:19449233-19449255 CCCTGGGAATGCAGGGGAGCTGG - Intronic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171257511 20:23701310-23701332 ACCTGGGCATGGAGCAGAGAGGG - Intergenic
1171264926 20:23763469-23763491 GCCTGGGCATGGAGCAGAGAGGG - Intergenic
1171289691 20:23975186-23975208 CACTGGGCATGTAGGGGGCGTGG + Intergenic
1171412944 20:24958736-24958758 CACGGGGCAGGGAGGGGAGTGGG + Intronic
1173198614 20:40937520-40937542 AACTGGATATGGAGGTGAGAGGG + Intergenic
1173460992 20:43243281-43243303 CACTGGGCAGCGAGGGCAGATGG + Intergenic
1173537986 20:43830369-43830391 CACTGGGCATGGAAGGAGGGAGG - Intergenic
1173703921 20:45096364-45096386 CTCTCTGCATGGAGGGGACAGGG + Intronic
1173864019 20:46302870-46302892 GCCTGGGCATGGGGGAGAGAAGG - Intronic
1175022521 20:55865729-55865751 GACTAGGCATGGAGTGTAGAAGG - Intergenic
1175890592 20:62314192-62314214 GAGTGGGCATGGAGAGGTGAAGG + Intronic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1177294854 21:19160888-19160910 GCCTGGGCATGGAGCAGAGAGGG + Intergenic
1178430263 21:32512561-32512583 CACTGGGAGAGGAGGGGAGGGGG + Intronic
1178848515 21:36193459-36193481 CACAGGGCGTTCAGGGGAGAAGG + Intronic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1181776764 22:25165808-25165830 CACCAGGCCTGGAGGTGAGAGGG + Intronic
1182736867 22:32537089-32537111 CACAGGGCATGCAGGCAAGAAGG + Intronic
1183353214 22:37344892-37344914 CTCTGGGCATGGAGGCGGCATGG - Intergenic
1183604352 22:38860031-38860053 CACTGGGCAGGCAGGTGGGAAGG - Intergenic
1183661224 22:39222587-39222609 CACTGGGGATTTAGGGGAGAAGG + Intergenic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1183948296 22:41339032-41339054 TCGTGGGCGTGGAGGGGAGAAGG - Exonic
1184366435 22:44054571-44054593 GGCTGGGCAGGGAGGGGACAGGG + Intronic
1184376513 22:44117121-44117143 CACGGGGCGGGGTGGGGAGAGGG - Intronic
1184829512 22:46975256-46975278 CACTCGGGGTGGAGGGTAGACGG + Intronic
1184880219 22:47299889-47299911 CACTGGGACTGCAGGGGAGCTGG - Intergenic
1185031582 22:48446289-48446311 CACTTGGCAGGGAGGAGAGAAGG - Intergenic
1185149805 22:49157760-49157782 CCCTGGGCACGGAGGAGGGATGG + Intergenic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185233260 22:49695181-49695203 AACCGGGCGTGGAGGGGAGCTGG + Intergenic
1185239814 22:49736653-49736675 CACTGGGCCTGCAGGGGGCAGGG - Intergenic
1185285363 22:49997529-49997551 CACTGGGGAAGGAAGGGAGGCGG - Intronic
949303768 3:2616151-2616173 CACTGGGCCTGTTGGGGGGATGG - Intronic
950038343 3:9903117-9903139 CACAGGGCAGGCAGGGGAGTGGG - Intronic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950193478 3:10993272-10993294 CCCAGGGCATGGAGGGGACGCGG + Intronic
950423503 3:12912267-12912289 GGCTGGGCTGGGAGGGGAGAGGG + Intronic
951115360 3:18854971-18854993 CACTGGGGATGGGGTGGAGGTGG - Intergenic
951706085 3:25545711-25545733 TGCTGGGCAGGGAGGAGAGAGGG - Intronic
953040706 3:39252774-39252796 CAATGGCGATGGAGGGGTGAAGG + Intergenic
953262601 3:41354238-41354260 CACTGTGGACTGAGGGGAGAAGG - Intronic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
954185115 3:48911045-48911067 CACTGGGGAAGGAGCGTAGATGG + Intergenic
954293083 3:49660036-49660058 CAGGAGGCATGGAGTGGAGAGGG - Intronic
954482971 3:50818661-50818683 CACTGGGACAGGAAGGGAGAGGG + Intronic
954485963 3:50851446-50851468 TCCTGGGCGTGGAGTGGAGAAGG + Intronic
955565753 3:60243432-60243454 TACTGGCCATGGAGAGGCGATGG + Intronic
955695584 3:61632805-61632827 CCATGGGCAGGGAGGGGAGGGGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957790868 3:84939672-84939694 CACAGGGCAGAGAGGGAAGAAGG + Intergenic
958801757 3:98764033-98764055 AACTGGGGATGGAGGAGACAGGG + Intronic
959430648 3:106251332-106251354 GCCTGGGCATGAAGTGGAGAAGG - Intergenic
959512023 3:107224798-107224820 CACTTGGGAAGGAGGGGAGTCGG - Intergenic
960986849 3:123286439-123286461 TACTGGGCATGGAAGGGACTGGG - Intronic
961094380 3:124142061-124142083 AATTGAGAATGGAGGGGAGAGGG - Intronic
961265048 3:125634914-125634936 CGCAGGGCTTGGTGGGGAGAAGG + Intergenic
961300694 3:125920276-125920298 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
961375201 3:126460598-126460620 GACTGGGCAGGGATGGGAGGTGG - Intronic
961415284 3:126752460-126752482 CCTTGGGCAGGGTGGGGAGAAGG + Intronic
961787776 3:129357917-129357939 CCCAGGGCAGGGAGGGGACAGGG + Intergenic
961831021 3:129623109-129623131 CACTGGGCAAGGACAGGAGGAGG - Intergenic
963141690 3:141950997-141951019 CACTGAGCATGGTGAGGAGGAGG - Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964210387 3:154220376-154220398 TACTGGAAATGGAAGGGAGATGG + Intronic
964429193 3:156586845-156586867 CACTGGCCATGGGGGAGAAAAGG + Intergenic
964919160 3:161875226-161875248 ACCTGGGCATGAAGGAGAGAGGG - Intergenic
964919182 3:161875339-161875361 GCCTAGGCATGGAGTGGAGAAGG - Intergenic
965853644 3:173062285-173062307 CACAAGGCAAGGAGGGAAGAAGG - Intronic
965940095 3:174169080-174169102 GCCTGGGCATGGAGCAGAGAGGG + Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966567872 3:181403277-181403299 AAATGAGCCTGGAGGGGAGAGGG + Intergenic
966665924 3:182471058-182471080 CACTGGGAATGATGGTGAGAGGG - Intergenic
966708718 3:182948347-182948369 AACTGGGCATGGACCAGAGAAGG + Intronic
966855816 3:184193267-184193289 TACTGGGCAAGAAGGGGAAATGG - Intronic
968594250 4:1474166-1474188 CCCTGGTGATGGAGGGGTGAGGG + Intergenic
968648330 4:1750644-1750666 CACCGGGCATGCAGGGGGCAAGG - Intergenic
968815352 4:2818755-2818777 CTCTGGGCAGGGAGGGGTCAGGG - Intronic
968963335 4:3756730-3756752 CACTGGGGATGGCAGGGAAAAGG + Intergenic
969577938 4:8047291-8047313 CACGGGGCATGGAGAGGACCTGG - Intronic
969721935 4:8896865-8896887 CCTTGGGCATGCAGGGCAGAAGG + Intergenic
969757062 4:9156936-9156958 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
970368942 4:15388952-15388974 CACTGAGCCTGGAGGTGATATGG - Intronic
970415152 4:15849532-15849554 CACTGAGCATGAAGAGGAGGAGG - Exonic
970558541 4:17259961-17259983 CACTTGACTTTGAGGGGAGAAGG + Intergenic
971531356 4:27693031-27693053 CCCTGGGCATTGAGCAGAGAGGG + Intergenic
971614066 4:28764638-28764660 GCCTGGGCATGGAGTGAAGAGGG - Intergenic
972729681 4:41781956-41781978 CACTGAGCATGGACGGGACTAGG + Intergenic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
974180650 4:58380067-58380089 TCCTGGGCATGGAGTGGAGAGGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
976576347 4:86676851-86676873 GACTGGGCAGAGAGGGTAGAGGG + Intronic
977764184 4:100777655-100777677 GCCTGGGCATGGAGTAGAGAGGG + Intronic
978859534 4:113431600-113431622 CACTGGAGTGGGAGGGGAGACGG + Intergenic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
980988630 4:139719017-139719039 CACAGGGCATGCTGGGCAGAGGG + Exonic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
982637290 4:157913049-157913071 CACTGGGCATGGGGTGGAGGGGG + Intergenic
983474288 4:168195692-168195714 GTATGGGCATGGAGTGGAGAGGG - Intergenic
983634034 4:169880049-169880071 CACTGGCCAGGGAATGGAGAAGG - Intergenic
983703110 4:170623081-170623103 GACCAGGCAGGGAGGGGAGAGGG + Intergenic
983831963 4:172338951-172338973 GTCCAGGCATGGAGGGGAGAGGG + Intronic
983981497 4:174002532-174002554 TACTGAGCAGGGAGGGAAGAGGG - Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985033416 4:185814741-185814763 CACGGGGCAAAGAGGGGAAAGGG - Intronic
985517843 5:356267-356289 TGCGGGGCATGGAGGGGAGCTGG + Intronic
985635117 5:1032092-1032114 CAGTGGGCAGGCGGGGGAGATGG - Intronic
986264598 5:6181209-6181231 CCCTCAGGATGGAGGGGAGAAGG - Intergenic
986325351 5:6668904-6668926 CACCGGGCAGGGAGGGGTGCTGG + Exonic
986774153 5:10998325-10998347 CACTTTGAATGGAGGGGAGAAGG + Intronic
987037383 5:14031991-14032013 CACTGTGAATGGAGGGGGCACGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987255737 5:16149129-16149151 CACTGGGCAAGGAAATGAGAAGG - Intronic
987373956 5:17217563-17217585 CACTGGGCAGGAAGGGGAGGGGG + Exonic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989460813 5:41696541-41696563 AACTGGGCATGTAGTGTAGAGGG + Intergenic
989460835 5:41696655-41696677 GCCTGGGTATGGAGAGGAGAGGG + Intergenic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
991964412 5:72076986-72077008 CCCTGGGCCAGAAGGGGAGAAGG - Intergenic
992427686 5:76674842-76674864 CACTGGGGAAAGAGGAGAGAGGG + Intronic
993155196 5:84213983-84214005 CACTGGTCATGTAGGGGGAAGGG - Intronic
993515061 5:88821763-88821785 AGCTGGGCATGGAGTGGGGAGGG + Intronic
994399725 5:99264072-99264094 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
994802051 5:104390979-104391001 CATTGAGGTTGGAGGGGAGATGG + Intergenic
995355585 5:111234460-111234482 CAGTGGTCATGGAGTTGAGAGGG + Intronic
995388725 5:111615854-111615876 CCCTGGGCATGGAGCAGAGAGGG + Intergenic
997202786 5:132022814-132022836 CTCTGGGAATGGAGGTGAGGGGG + Intergenic
997597853 5:135119094-135119116 CACAGGGGATAGAGGGGACAGGG - Intronic
997656329 5:135557566-135557588 CACTGGGAATGGAGGGGGCTGGG - Intergenic
997718830 5:136062124-136062146 CACTGGGCAAGCTGGGGAGCAGG - Intronic
998415703 5:141944856-141944878 CACTGGGCCTGGACAGGAGTGGG - Exonic
998557618 5:143140860-143140882 CACTGGGCCTGTCTGGGAGAGGG - Intronic
998703916 5:144737531-144737553 GCCTGGGCATGGAGCAGAGAGGG + Intergenic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999542944 5:152593939-152593961 AATTGGGGATGGAGGGGGGATGG - Intergenic
1001873970 5:175183156-175183178 CACTGGACAAGGAAGGTAGATGG + Intergenic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1002984277 6:2173442-2173464 TACAGGGCATGGAGGGAAGGAGG + Intronic
1003054056 6:2803227-2803249 CACTGGGCTTGTAAGGGTGACGG - Intergenic
1004174236 6:13325118-13325140 CACGGTACATGGACGGGAGAGGG + Exonic
1004478289 6:15994679-15994701 CAGTGGGCTTGGGAGGGAGATGG + Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004576140 6:16897060-16897082 CACTAAGCTTGGAGAGGAGAAGG + Intergenic
1004599355 6:17132824-17132846 GTCTGGGCATGGAGTGGACAGGG - Intergenic
1004819173 6:19348103-19348125 CACTGGGGGTGGAGGGGAGGTGG - Intergenic
1005245954 6:23885441-23885463 CACTGTGGAAGGAGGGGTGAAGG - Intergenic
1005605774 6:27475669-27475691 AACTGGGGGAGGAGGGGAGAAGG + Intergenic
1005898335 6:30196750-30196772 CAGGGGGCAGGAAGGGGAGAAGG + Intronic
1005952886 6:30644446-30644468 CTCTGGGCATGGAGCAGGGAAGG - Intronic
1006211178 6:32396271-32396293 CACAGAGCATGGAGGTGAGGTGG - Exonic
1006368947 6:33632788-33632810 GGCTGGTCCTGGAGGGGAGAAGG + Intronic
1006582820 6:35086636-35086658 CACTGGGCAGGAAGGGGATATGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007124928 6:39418006-39418028 TACTTGGCTTGAAGGGGAGAAGG - Intronic
1007125602 6:39423183-39423205 GGCTGGGCTTGGAAGGGAGAAGG + Intronic
1007169434 6:39852330-39852352 CCCTGGACAGGGAGAGGAGAAGG - Intronic
1007182027 6:39935820-39935842 AACTGGGTATGGGGGAGAGAAGG + Intergenic
1007336525 6:41158819-41158841 GACTGGGCAGGGATGGGAGGCGG - Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007693872 6:43719524-43719546 CCCTGGGAATGGTGGGGAGATGG + Intergenic
1008614161 6:53209847-53209869 AGCTGGGCATGGATAGGAGAGGG - Intergenic
1008897231 6:56570229-56570251 CACAGGCCAGGGAGGGGGGATGG + Intronic
1009656911 6:66558847-66558869 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
1010475039 6:76276405-76276427 GCCTGGGCATGGAGTAGAGAGGG + Intergenic
1010905883 6:81487674-81487696 CACTGGGCATGGAGCTGACAAGG - Intergenic
1011311199 6:85981492-85981514 GAATGTGCATGGAGTGGAGAAGG + Intergenic
1011957198 6:93037708-93037730 GCCTGGGCATAGAGTGGAGAGGG + Intergenic
1012052608 6:94362548-94362570 CTCTGGGCCTGGAGGGGGGTGGG + Intergenic
1013015193 6:106154684-106154706 TGCTGTGCATGGAGGGGAAAGGG + Intergenic
1013255403 6:108380005-108380027 GCCTGGGCATGGAGCAGAGAGGG + Intronic
1013289665 6:108709133-108709155 CCCTGGGAATGGTGGGGAGCAGG + Intergenic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1014677503 6:124385253-124385275 GACTGGGCATGTCAGGGAGATGG + Intronic
1014918769 6:127187102-127187124 CAGCGGGCATGGTGGTGAGATGG + Intronic
1015146916 6:129997296-129997318 CACTGGGGATGGAGAGGCCAAGG + Intergenic
1015306554 6:131715406-131715428 GCCTGGGCATGAAGTGGAGATGG - Intronic
1015350356 6:132210595-132210617 GCCTGGGCATAGAGTGGAGAGGG + Intergenic
1015354034 6:132255906-132255928 CTCTGGGCAGGGCGTGGAGAGGG - Intergenic
1016464357 6:144310622-144310644 CACTGGGCGTGGCGGGGGGTGGG + Intronic
1016684650 6:146867424-146867446 CACTGGGCATTGAGTGGAGTAGG - Intergenic
1017771840 6:157650103-157650125 CACTGGGGGTGCACGGGAGAGGG + Intronic
1018033860 6:159865619-159865641 CACTGGGCAAGGAGGGGAAAGGG + Intergenic
1018050785 6:160006101-160006123 CACGGGGCATGCAGGGTACAGGG - Intronic
1018050803 6:160006161-160006183 CACAGGGCATGCAGGGTACAGGG - Intronic
1018452201 6:163919500-163919522 CACGTGGCAGGGAGGGGAGGAGG + Intergenic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1018963895 6:168468471-168468493 CACTGCCCATGGCAGGGAGAAGG - Intronic
1019323127 7:424605-424627 CTCGGGGCTGGGAGGGGAGAAGG + Intergenic
1019537445 7:1536732-1536754 TTCTGTGCATGGTGGGGAGAGGG + Intronic
1020089736 7:5332538-5332560 CCCTAGGCTGGGAGGGGAGAGGG + Intronic
1020091726 7:5345689-5345711 CACCGGGCCTGGAGGAGAGTGGG - Exonic
1020153180 7:5699713-5699735 CACTGGACATGAAGGGCAGCAGG + Intronic
1020321236 7:6940126-6940148 CACTTGGAACGGAGGGCAGAGGG + Intergenic
1021189420 7:17602811-17602833 GCCTGGTCATGGAGTGGAGACGG - Intergenic
1022307143 7:29157324-29157346 GGCTGGGCATTGAGTGGAGAAGG - Intronic
1022385009 7:29891616-29891638 AACTGAGCAAGGATGGGAGATGG - Intronic
1022388332 7:29922613-29922635 CACTGGGCATGGGGTGGTGGTGG - Intronic
1023499233 7:40830356-40830378 CACGGGGCATGGACAGGGGAGGG - Intronic
1023585875 7:41729280-41729302 TACTGGGGGTGGAGGGGAAATGG - Intergenic
1023861631 7:44220498-44220520 CCCTGGGCACAGAGGGGACAGGG + Intronic
1023869310 7:44254336-44254358 CCTTGGGCGTGGAGGGGAGGTGG + Intronic
1024346896 7:48322555-48322577 CCCTGGGCATTGAGAGGACAGGG - Intronic
1024626612 7:51213319-51213341 CACTGCGGTTGGACGGGAGATGG - Intronic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1027495134 7:78878771-78878793 GCCTGGGCATGGAGTGGAGAAGG - Intronic
1027618183 7:80449997-80450019 AACAGGGCTTGTAGGGGAGAGGG + Intronic
1027934899 7:84589614-84589636 CCCTGGGCGTGGAGCAGAGAGGG - Intergenic
1028154568 7:87415207-87415229 TACTGGGCAGGGAGTGGGGAGGG - Intronic
1028431215 7:90749292-90749314 GACTGGGCATGGAGTGAAGAAGG - Intronic
1028577627 7:92369887-92369909 CTCTGTCCATGGAAGGGAGAGGG + Intronic
1028582185 7:92420027-92420049 CACTGGCCAAGAAGGGGACAGGG - Intergenic
1029047298 7:97643899-97643921 CAATGGGCATGGAGGGGGGAAGG + Intergenic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1029545159 7:101206677-101206699 AAATGGGCAGGGAGGGGAGCTGG + Intronic
1029553544 7:101251980-101252002 GACCGGGCATGGTGGGTAGAAGG - Intronic
1031237652 7:119197189-119197211 GCCTGGGCATGAAGTGGAGAAGG - Intergenic
1031237717 7:119197622-119197644 TCCTGGGCATGGACCGGAGAGGG - Intergenic
1032408953 7:131678937-131678959 CAATGGGGAAGAAGGGGAGAGGG + Intergenic
1032546666 7:132749459-132749481 CACTGGGCATGCAGCAGGGAAGG - Intergenic
1033730995 7:144179094-144179116 GCCTGGGCATGAAGTGGAGATGG + Intergenic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034410906 7:150941689-150941711 CACATGGCAGGGAGGGGAGAGGG + Intergenic
1034628312 7:152511299-152511321 GACTTGGCATGCAGAGGAGATGG - Intergenic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1034999934 7:155604399-155604421 CTCTGAGGATGGAGGTGAGAGGG + Intergenic
1035594355 8:843476-843498 CACTGTGCATGGTGTGGAGTGGG + Intergenic
1035766531 8:2110599-2110621 CACTGGGCATTAAGGGAAAAAGG - Intronic
1035793178 8:2326215-2326237 CACTGGGCAGGGAGAGGAGGTGG + Intergenic
1035799626 8:2395490-2395512 CACTGGGCAGGGAGAGGAGGTGG - Intergenic
1036207534 8:6816001-6816023 CACTCAGGATGGAGGGGAGGGGG - Intronic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036380292 8:8232251-8232273 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
1036559428 8:9888988-9889010 CACTGGGCATGCAGGTGAGCAGG + Intergenic
1036849268 8:12190409-12190431 CACTTGGAACGGAGGGCAGAGGG + Intronic
1036870628 8:12432683-12432705 CACTTGGAACGGAGGGCAGAGGG + Intronic
1036969144 8:13334489-13334511 GACTGCGCAGGCAGGGGAGAAGG + Intronic
1037487178 8:19358608-19358630 CACTTGGCATGGTGGGGAAAGGG + Intronic
1038194917 8:25358524-25358546 CACTGAGCATGAAGGAGAGGAGG - Intronic
1039552510 8:38453294-38453316 CCCTGGGCCTCCAGGGGAGACGG - Intronic
1039573662 8:38606278-38606300 CATTGGGCATGGGCAGGAGAGGG - Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040391261 8:46952758-46952780 CACTGGGCACAGAAGGGAGGTGG - Intergenic
1040551206 8:48438991-48439013 CGCTGGTGCTGGAGGGGAGATGG + Intergenic
1040570522 8:48605389-48605411 GACTGTGAATGGAGGAGAGAAGG + Intergenic
1040758054 8:50804797-50804819 GCCTGGGCATGGAGCGGAGGGGG - Intergenic
1041095403 8:54344285-54344307 GGCTGGGCACGGTGGGGAGATGG + Intergenic
1041313656 8:56540415-56540437 CGATGGACATGCAGGGGAGAGGG + Intergenic
1041423242 8:57692819-57692841 CAGAGGTCATGGAGGGGAGAGGG + Intergenic
1041445645 8:57948539-57948561 GCCTGGGCATGGAGCAGAGAGGG + Intergenic
1041887669 8:62830635-62830657 GCCTGGGCTTGGAGTGGAGAGGG - Intronic
1041986970 8:63933380-63933402 CACAGGGGCTGGAGGGGGGAAGG - Intergenic
1042109700 8:65367596-65367618 GCCTGGGCATGGAGTGTAGAGGG - Intergenic
1043213153 8:77550881-77550903 CCCTGGGCATGGAGTAGAGAGGG + Intergenic
1043261783 8:78209504-78209526 CACTGGGTGTGGTAGGGAGAGGG + Intergenic
1044308565 8:90666168-90666190 TGCTGGGCATGGAGCGGAGACGG + Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045094619 8:98784837-98784859 GCCTGGGCATGGAGCAGAGAGGG - Intronic
1045727072 8:105186306-105186328 TCCTGGGCACGGAGTGGAGAGGG + Intronic
1046606324 8:116375414-116375436 GTCTGGGCATGGAATGGAGAGGG + Intergenic
1047463948 8:125094133-125094155 TATTGGGTATGAAGGGGAGAAGG + Intronic
1047566204 8:126046856-126046878 GCCTGGGCATGGAGAAGAGAAGG + Intergenic
1049273172 8:141706901-141706923 CACTGAGGAGGGAGGGGAGCAGG + Intergenic
1049623081 8:143607346-143607368 CACTGGGGATGGAGGGCTCAGGG - Intronic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1049894070 9:97604-97626 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052535623 9:29742930-29742952 CACTGGACAGGCAAGGGAGAAGG - Intergenic
1052764611 9:32628484-32628506 GAATGGGATTGGAGGGGAGAGGG - Intergenic
1052963586 9:34320726-34320748 CCCTTGGGAAGGAGGGGAGAGGG + Intronic
1053314601 9:37040929-37040951 CAGCTGGCGTGGAGGGGAGAGGG + Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1053735296 9:41097688-41097710 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1054693083 9:68333709-68333731 TAGTGGGCATGGAAGGGAGGGGG + Intronic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1054806363 9:69399648-69399670 CACTGGGCCTGGAGAGGTCAAGG - Intergenic
1055471627 9:76617684-76617706 GGCTGGGCATGGAGGAGGGAGGG - Intronic
1055636331 9:78282598-78282620 CACTGGGGAGGCAAGGGAGAGGG + Intergenic
1055818272 9:80232446-80232468 GTCTGGGCATGGAGCAGAGAGGG + Intergenic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1056601934 9:88053389-88053411 CTCTGCGCAAGGAGGGGAGGAGG - Intergenic
1056844981 9:90029838-90029860 CACAGGGCATGGATGTGAGAGGG + Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057191118 9:93088184-93088206 CACTGGGCAGGGGGGCCAGAGGG + Intergenic
1057275329 9:93673314-93673336 AGATGGGCATGGAGAGGAGACGG - Intronic
1057379298 9:94554160-94554182 CACTGCCCATGGCGGGGTGAGGG - Intergenic
1057488143 9:95502173-95502195 CACAGGGGCTGGAGGGGAGAGGG - Intronic
1057861032 9:98641047-98641069 CAATAGGGGTGGAGGGGAGAAGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059093264 9:111384482-111384504 CATTGGGAATGGAGTGGAGCAGG - Intronic
1059263230 9:112999721-112999743 CACAGGGCAAGGTGGGCAGAAGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059541498 9:115134872-115134894 CCCTGAGCATGGAGGGAGGAAGG - Intergenic
1059548086 9:115199227-115199249 GACTGGTGATGGTGGGGAGAGGG + Intronic
1060014191 9:120072085-120072107 CACTGGGCATGGGGTAGACAGGG - Intergenic
1060104785 9:120866821-120866843 CCTTGGGCGTGGTGGGGAGAGGG - Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060953126 9:127617737-127617759 CACAGGGCATCGAGGGGCAAGGG - Intronic
1061055246 9:128219028-128219050 CACTGGACAGGGCGGCGAGAGGG - Exonic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061232188 9:129321396-129321418 CACTGGGCAGGGAAAGGCGAAGG - Intergenic
1061509482 9:131051798-131051820 CACTGGGAAAGGAGGAGGGAGGG + Intronic
1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG + Intergenic
1062191537 9:135250250-135250272 CACTGGGGATGGTGGGGATGAGG + Intergenic
1062254556 9:135614866-135614888 CCCTGGTCAGGGAGGGCAGAGGG - Intergenic
1062255811 9:135620070-135620092 GACTGGGCAGACAGGGGAGACGG - Intergenic
1062389154 9:136327308-136327330 CCCAGGGAATGCAGGGGAGAGGG - Intergenic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1062558477 9:137128251-137128273 CACCGGGCAGGGTGGGGAGGGGG - Intergenic
1062599251 9:137312587-137312609 CCTTGGGCCTGGAGAGGAGAGGG - Intronic
1186309987 X:8307434-8307456 GCCTGGGCATGGAGCAGAGAGGG - Intergenic
1186746017 X:12570204-12570226 CACTGGCAATGCAGGGGAAAGGG - Intronic
1186924816 X:14321971-14321993 CAGTTGACCTGGAGGGGAGAAGG - Intergenic
1187146195 X:16639602-16639624 CACTGGGCAGTGGGGGAAGAGGG - Intronic
1187258548 X:17663193-17663215 TTCGTGGCATGGAGGGGAGAGGG + Intronic
1190117293 X:47634598-47634620 CACTGGGCATGCAAGGGAGAGGG - Intergenic
1190119754 X:47650395-47650417 CTCTGGGCCTGGAGGGTGGAGGG - Intronic
1190378028 X:49810036-49810058 CACTGACCTTGGAGGGGAGAAGG - Intergenic
1191004799 X:55699905-55699927 GACCAGGCATGGAGTGGAGAAGG - Intergenic
1191774067 X:64793352-64793374 GCTTGGGCATGGAGTGGAGAGGG - Intergenic
1191944574 X:66517941-66517963 CACAGGGCAAGGAAGTGAGAAGG - Intergenic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193031839 X:76907120-76907142 GCCTGGGCATGGAGCAGAGAGGG - Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1193746465 X:85288440-85288462 CAGTGGGCACTGAGGGGAGGTGG - Intronic
1194213295 X:91096124-91096146 TACTGGGCATTGAGTGGAGATGG - Intergenic
1194923554 X:99796317-99796339 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
1194923599 X:99796652-99796674 ACCTGGGCATGGAGTAGAGAGGG + Intergenic
1196892572 X:120305659-120305681 CCATGGGGAGGGAGGGGAGAGGG + Intronic
1197285741 X:124593212-124593234 CCCTGGGCATGCAGCAGAGAGGG + Intronic
1197976847 X:132174865-132174887 GAGTGGGCATAGAAGGGAGATGG + Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198705994 X:139448429-139448451 CACCGGGCAGGGAGGGGTGCTGG + Intergenic
1198777664 X:140197892-140197914 CACTGAGCATGGAGGGGTGGTGG + Intergenic
1198968164 X:142249973-142249995 GCCTGGGCGTGGAGAGGAGAGGG + Intergenic
1199178984 X:144829788-144829810 CTCTGTGCATGCAGGAGAGAAGG + Intergenic
1199252473 X:145679161-145679183 CACTGGATATGGAGATGAGAAGG - Intergenic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1201788391 Y:17809558-17809580 CTCTGGCCATGGCGGGGCGAAGG + Intergenic
1201813162 Y:18096430-18096452 CTCTGGCCATGGCGGGGCGAAGG - Intergenic
1201904907 Y:19077856-19077878 CACTGGGCAAGGAGAGCAGTGGG + Intergenic
1202196676 Y:22305379-22305401 CTCAGGGCATGGAAGGGAGCCGG + Intergenic
1202584389 Y:26408646-26408668 CACTGGCCTTGGCGGGGAGCCGG - Intergenic