ID: 1007566042

View in Genome Browser
Species Human (GRCh38)
Location 6:42851099-42851121
Sequence CCTCCGTCTCCCAAGTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007566042_1007566044 17 Left 1007566042 6:42851099-42851121 CCATTGAACTTGGGAGACGGAGG No data
Right 1007566044 6:42851139-42851161 CGTGCCACTGCACTCCAGCCTGG 0: 24731
1: 122279
2: 204638
3: 210833
4: 145962
1007566042_1007566045 18 Left 1007566042 6:42851099-42851121 CCATTGAACTTGGGAGACGGAGG No data
Right 1007566045 6:42851140-42851162 GTGCCACTGCACTCCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007566042 Original CRISPR CCTCCGTCTCCCAAGTTCAA TGG (reversed) Intronic