ID: 1007566044

View in Genome Browser
Species Human (GRCh38)
Location 6:42851139-42851161
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708443
Summary {0: 24731, 1: 122279, 2: 204638, 3: 210833, 4: 145962}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007566042_1007566044 17 Left 1007566042 6:42851099-42851121 CCATTGAACTTGGGAGACGGAGG 0: 1
1: 65
2: 630
3: 2026
4: 3708
Right 1007566044 6:42851139-42851161 CGTGCCACTGCACTCCAGCCTGG 0: 24731
1: 122279
2: 204638
3: 210833
4: 145962

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr