ID: 1007566045

View in Genome Browser
Species Human (GRCh38)
Location 6:42851140-42851162
Sequence GTGCCACTGCACTCCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 707439
Summary {0: 52453, 1: 149973, 2: 210600, 3: 182318, 4: 112095}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007566042_1007566045 18 Left 1007566042 6:42851099-42851121 CCATTGAACTTGGGAGACGGAGG 0: 1
1: 65
2: 630
3: 2026
4: 3708
Right 1007566045 6:42851140-42851162 GTGCCACTGCACTCCAGCCTGGG 0: 52453
1: 149973
2: 210600
3: 182318
4: 112095

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007566045 Original CRISPR GTGCCACTGCACTCCAGCCT GGG Intronic
Too many off-targets to display for this crispr