ID: 1007566100

View in Genome Browser
Species Human (GRCh38)
Location 6:42851713-42851735
Sequence CTGACTATCAGCTCCTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007566100_1007566110 17 Left 1007566100 6:42851713-42851735 CCCACATAGGAGCTGATAGTCAG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1007566110 6:42851753-42851775 GCAGGATATAAGGTTACTGGGGG No data
1007566100_1007566103 -5 Left 1007566100 6:42851713-42851735 CCCACATAGGAGCTGATAGTCAG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1007566103 6:42851731-42851753 GTCAGGATCATAATCCTAGCAGG No data
1007566100_1007566105 7 Left 1007566100 6:42851713-42851735 CCCACATAGGAGCTGATAGTCAG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1007566105 6:42851743-42851765 ATCCTAGCAGGCAGGATATAAGG 0: 1
1: 0
2: 0
3: 4
4: 95
1007566100_1007566104 -1 Left 1007566100 6:42851713-42851735 CCCACATAGGAGCTGATAGTCAG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1007566104 6:42851735-42851757 GGATCATAATCCTAGCAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1007566100_1007566109 16 Left 1007566100 6:42851713-42851735 CCCACATAGGAGCTGATAGTCAG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1007566109 6:42851752-42851774 GGCAGGATATAAGGTTACTGGGG 0: 1
1: 0
2: 0
3: 16
4: 124
1007566100_1007566108 15 Left 1007566100 6:42851713-42851735 CCCACATAGGAGCTGATAGTCAG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1007566108 6:42851751-42851773 AGGCAGGATATAAGGTTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 99
1007566100_1007566107 14 Left 1007566100 6:42851713-42851735 CCCACATAGGAGCTGATAGTCAG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1007566107 6:42851750-42851772 CAGGCAGGATATAAGGTTACTGG 0: 1
1: 0
2: 1
3: 4
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007566100 Original CRISPR CTGACTATCAGCTCCTATGT GGG (reversed) Intronic
904789661 1:33009743-33009765 TTGACCTTCAGCTCCTATGCAGG - Intronic
905014288 1:34766566-34766588 CTGACTATCAGCTTAAATGGAGG - Intronic
905143027 1:35864066-35864088 TTAACTATCAGCTCCTTTGAAGG + Intergenic
910186144 1:84542612-84542634 CTGACTCTCTGCTCAGATGTGGG + Intergenic
912164035 1:107021046-107021068 CTGACTAGTGGCTACTATGTTGG - Intergenic
1063197000 10:3752941-3752963 CAGATTATCAGCTCCTATTTTGG + Intergenic
1064343433 10:14508115-14508137 CTGGCTATCAGCTCTAATGGAGG + Intergenic
1064946412 10:20794930-20794952 CTAACCTTCAGCTCCTTTGTTGG - Intronic
1066229848 10:33421779-33421801 CTGAAGATCATCTCCTATTTGGG + Intergenic
1068726843 10:60312575-60312597 CTGACTATGAGGTCCCATCTAGG - Intronic
1071843461 10:89497600-89497622 CTGCCTCTCACCTGCTATGTAGG - Intronic
1072745983 10:97939490-97939512 CAGACCAACAGCTCCTAGGTTGG + Intronic
1074603458 10:114937676-114937698 TTGAATATCAGCTCTTCTGTGGG - Intergenic
1077585085 11:3445264-3445286 GTGGCTAGCAGCTCCCATGTTGG + Intergenic
1079118546 11:17657697-17657719 CTGCCTATCAGCCTATATGTGGG + Intergenic
1084241988 11:67827831-67827853 GTGGCTAGCAGCTCCCATGTTGG + Intergenic
1085065484 11:73491678-73491700 CTGACTCTCATCTCATACGTGGG + Intronic
1089262893 11:117234532-117234554 CTGAGTATCAGGTGCTGTGTTGG - Intronic
1092412230 12:8262530-8262552 GTGGCTAGCAGCTCCCATGTTGG + Intergenic
1098417477 12:70251965-70251987 ATAAATATCAGCACCTATGTAGG - Intronic
1104677239 12:130719858-130719880 CTGACCATCAGCACCTCTGCGGG + Intergenic
1105682669 13:22745224-22745246 CTGCCTATCTGCTCCTCTCTAGG + Intergenic
1105765912 13:23559243-23559265 CTGACAATCACCCCCTTTGTTGG - Intergenic
1112037155 13:95507411-95507433 CTGAGTTTCAACTCCTTTGTTGG + Intronic
1113575624 13:111393395-111393417 CTGACCATCTGCTACTATTTGGG + Intergenic
1115468155 14:33738662-33738684 CTGAATGTCAGCTCATATTTGGG - Intronic
1118636731 14:67754872-67754894 CCCACTACCAGCTCCTCTGTAGG + Intronic
1120603494 14:86542205-86542227 CTCACTGTCAGCTGCTAAGTAGG - Intergenic
1122178168 14:99936526-99936548 CTGACTGTGAGCCCCTATGGAGG + Intronic
1131046272 15:89318493-89318515 CTGGCCATGTGCTCCTATGTGGG - Intronic
1131958802 15:97766391-97766413 CTGTGTATCAGCTCCTCTGTTGG - Intergenic
1137463276 16:48685502-48685524 CTGTGTATCAGCTCATATATGGG + Intergenic
1143308962 17:5972456-5972478 CTGACTTTCAGCTCCTCTGAAGG - Intronic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1153106418 18:1533332-1533354 CTGAGTTTCAGCTCTTGTGTAGG - Intergenic
1155733430 18:29191109-29191131 CTAACCATAAACTCCTATGTCGG - Intergenic
1160003411 18:75049236-75049258 CTGAGTATCAGGTAGTATGTTGG + Intronic
1163045886 19:14641579-14641601 CTGACTGTCATCACCTACGTGGG - Exonic
930231453 2:48847797-48847819 CTGACTTGCAGCTCCAATGCTGG - Intergenic
932604871 2:73158190-73158212 CTGTCTAACTGCTCCTCTGTGGG - Intergenic
936171646 2:110181897-110181919 CTGGCTATCAGCTCCTGTATTGG - Intronic
938247805 2:129792444-129792466 CTGACTGCCAGCACCTAGGTGGG - Intergenic
940440681 2:153712784-153712806 CTGACTACCTGCTCCAATGATGG - Intergenic
940766664 2:157797161-157797183 GTGACTATCAGCTACCATATAGG + Intronic
941942477 2:171056802-171056824 CTGACTATCATCTGTTATTTTGG + Intronic
1169568450 20:6881210-6881232 CTGACTTTCTGCCCTTATGTAGG - Intergenic
1176162604 20:63655490-63655512 CTGACTGTCAGCACCTAGGCAGG + Intergenic
1177055348 21:16294784-16294806 CTGAGTATCCTCTCCTCTGTTGG + Intergenic
1178802086 21:35805570-35805592 CTGCCTATCAGCTGCTATTTTGG + Intronic
1179591068 21:42408694-42408716 GTGACAATGAACTCCTATGTTGG + Intronic
956194544 3:66639036-66639058 CAGATTATCAGCTCCTCTTTAGG - Intergenic
956991970 3:74777233-74777255 CTGTCTCTCAGCTCCAATTTTGG + Intergenic
961296006 3:125884976-125884998 GTGGCTAGCAGCTCCCATGTTGG - Intergenic
961429316 3:126870009-126870031 CTGACTAGCAGCTCCCAGGTTGG + Intronic
961889789 3:130121185-130121207 ATGTCTAGCAGCTCCCATGTTGG + Intergenic
964162211 3:153659223-153659245 CTGATTATCAGCTCTTTTGATGG - Intergenic
965264023 3:166518009-166518031 CTGACTTTCAGTTCTTATGAAGG - Intergenic
969000274 4:3975155-3975177 GTGGCTAGCAGCTCCCATGTTGG + Intergenic
969366078 4:6694859-6694881 TTGATTATCAGCATCTATGTGGG - Intronic
969753746 4:9133502-9133524 GTGGCTAGCAGCTCCCATGTTGG - Intergenic
969813634 4:9669691-9669713 GTGGCTAGCAGCTCCCATGTTGG - Intergenic
970928004 4:21475417-21475439 CTGAGTATCAGTTCATAGGTAGG - Intronic
976908168 4:90266490-90266512 CTGATTTTCAGTTCGTATGTAGG - Intronic
979164365 4:117507985-117508007 CTGTATATCAGGTCCTATTTTGG - Intergenic
983548341 4:168987282-168987304 CTGACTCTCAGTTCATATCTTGG - Intronic
987947444 5:24630034-24630056 CTGAACATCTGCTACTATGTGGG + Intronic
991218269 5:64181612-64181634 CTGCCCATCTGCTCCTATCTAGG - Intronic
992208804 5:74456959-74456981 GTGAGTATCAGCTACTGTGTAGG - Intergenic
996810394 5:127510917-127510939 TTGATTTTCAGCTCCTCTGTTGG - Intergenic
997869244 5:137492401-137492423 CTGTCTCCCTGCTCCTATGTTGG - Intronic
998379478 5:141713906-141713928 CTGACTCTCAGCTACTCTGTTGG - Intergenic
999461813 5:151763281-151763303 CTGACCATTGGCTGCTATGTTGG - Intronic
1003498902 6:6687764-6687786 CTAACTATCCGGTACTATGTTGG - Intergenic
1004187937 6:13437559-13437581 GTGACTAGCGGCTACTATGTTGG + Intronic
1006627357 6:35406791-35406813 CCCACTACCAGCTCATATGTGGG + Intronic
1006983731 6:38164605-38164627 CTCATTATAAGCTCCTGTGTGGG - Intergenic
1007566100 6:42851713-42851735 CTGACTATCAGCTCCTATGTGGG - Intronic
1007857131 6:44869484-44869506 CTGAAAATCAGCACGTATGTAGG + Intronic
1009247262 6:61254017-61254039 ATGACTTTCAGCTCCTATTAAGG + Intergenic
1013212903 6:108002577-108002599 ATGACTGTCAGCTTTTATGTAGG - Intergenic
1014159011 6:118145428-118145450 TTGACTTTCAGCTTCTCTGTAGG - Intronic
1018376353 6:163217315-163217337 CTGCCTATCACCTGCTCTGTTGG - Intronic
1019356395 7:582202-582224 CAGACTTGCAGCTCCCATGTGGG + Intronic
1023218052 7:37886519-37886541 CTGAATATCAGATTCTATGCTGG + Intronic
1024254027 7:47526615-47526637 CTGCCTGTCAGATGCTATGTGGG - Intronic
1032952370 7:136929587-136929609 CTGATTGACAGCTCTTATGTGGG - Intronic
1036918683 8:12831065-12831087 CTGACTGGCAGCTCTCATGTTGG - Intergenic
1044904647 8:96987992-96988014 CTGTCTGTCAGCAACTATGTAGG + Intronic
1052046875 9:23803989-23804011 CTAACAAACAGCTCATATGTAGG + Intronic
1052935936 9:34093212-34093234 CTGACTTTCAGTTTCTTTGTTGG - Intronic
1057776780 9:98017835-98017857 CTGACTAGCTGCTCCGAGGTTGG + Intergenic
1060422585 9:123480013-123480035 CAGATTATCAGCTCCTACTTCGG - Intronic
1061012663 9:127964564-127964586 CTGACTTTCTGCTCCTGTGAGGG - Intronic
1185895665 X:3856381-3856403 CTGGCTACCAAGTCCTATGTAGG + Intergenic
1185900784 X:3894805-3894827 CTGGCTACCAAGTCCTATGTAGG + Intergenic
1185905899 X:3933244-3933266 CTGGCTACCAAGTCCTATGTAGG + Intergenic
1187909994 X:24102842-24102864 TTGATTATCAGTTCCTATTTTGG + Intergenic
1191250101 X:58256126-58256148 CAGACTAGCAGCCCCTACGTTGG + Intergenic
1192782481 X:74308169-74308191 GTGACTCTCAGCCCCTAAGTGGG + Intergenic
1192841049 X:74856684-74856706 CTGATTTTCAGCTCTTATGAAGG - Intronic
1193484369 X:82068465-82068487 CTGAATATCAGCAGCTTTGTGGG + Intergenic
1195519705 X:105816856-105816878 CTGGCTATCATTTCCTATTTTGG - Intergenic
1197085675 X:122471589-122471611 CTGAATATTAGTTCCTATGGAGG + Intergenic
1199787398 X:151117401-151117423 CTGCCTATCAGTTCCTGAGTGGG - Intergenic
1201923175 Y:19256192-19256214 CAGACTATCAGCTGATCTGTTGG + Intergenic