ID: 1007569394

View in Genome Browser
Species Human (GRCh38)
Location 6:42878712-42878734
Sequence CTCACGCAGCCTCCGCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007569391_1007569394 9 Left 1007569391 6:42878680-42878702 CCCAGGCTGGAGTGCAAGTGGCA 0: 115
1: 253
2: 553
3: 1232
4: 7084
Right 1007569394 6:42878712-42878734 CTCACGCAGCCTCCGCCTTCTGG No data
1007569392_1007569394 8 Left 1007569392 6:42878681-42878703 CCAGGCTGGAGTGCAAGTGGCAC 0: 73
1: 215
2: 418
3: 734
4: 1879
Right 1007569394 6:42878712-42878734 CTCACGCAGCCTCCGCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007569394 Original CRISPR CTCACGCAGCCTCCGCCTTC TGG Intergenic
No off target data available for this crispr