ID: 1007570708

View in Genome Browser
Species Human (GRCh38)
Location 6:42888601-42888623
Sequence TCTGAGTTACAGATGGTGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007570708_1007570712 2 Left 1007570708 6:42888601-42888623 CCCTGCACCATCTGTAACTCAGA 0: 1
1: 1
2: 0
3: 12
4: 162
Right 1007570712 6:42888626-42888648 TCCCCACCATTTCTTCCCCTGGG 0: 2
1: 0
2: 1
3: 29
4: 292
1007570708_1007570720 23 Left 1007570708 6:42888601-42888623 CCCTGCACCATCTGTAACTCAGA 0: 1
1: 1
2: 0
3: 12
4: 162
Right 1007570720 6:42888647-42888669 GGCTTCAGAATAGAATTGCCTGG 0: 2
1: 0
2: 3
3: 24
4: 258
1007570708_1007570711 1 Left 1007570708 6:42888601-42888623 CCCTGCACCATCTGTAACTCAGA 0: 1
1: 1
2: 0
3: 12
4: 162
Right 1007570711 6:42888625-42888647 ATCCCCACCATTTCTTCCCCTGG 0: 2
1: 0
2: 3
3: 21
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007570708 Original CRISPR TCTGAGTTACAGATGGTGCA GGG (reversed) Exonic
900918701 1:5657197-5657219 TATGAGTTAAAGATCCTGCAAGG + Intergenic
902240040 1:15082267-15082289 TCTGAGTTGGAGGTGGCGCAGGG - Intronic
903384924 1:22920064-22920086 TCTGAGTTACAGATGCACCTTGG + Intergenic
904345721 1:29867593-29867615 TCTGAGACACAGATGGGACAAGG + Intergenic
904838258 1:33353686-33353708 CCTGAGTTGCAGGTGGTCCATGG + Intronic
905787112 1:40767183-40767205 TATGAGTCACAGATGGTGAGGGG + Intronic
909657596 1:78047989-78048011 TTTTAGTTACAGATGGTCCTGGG + Intronic
911329072 1:96505705-96505727 TCTGAGTTACTTAGGGTGCAGGG + Intergenic
912300385 1:108510042-108510064 CCAGAGTTATAGATGGCGCAGGG - Intergenic
912726659 1:112064575-112064597 TCTGGATTACAGCTGGCGCAGGG - Intergenic
913060294 1:115198214-115198236 TCTGACTTACAGGAGGTGCTAGG + Intergenic
917647796 1:177046198-177046220 TTGGAGTTACAGCTGGTGCCAGG - Intronic
920641494 1:207755918-207755940 TCTGAGTGACATATTGTGCTGGG + Intronic
920751042 1:208677371-208677393 TTAGAGTTAAAGATGGTTCACGG + Intergenic
921621104 1:217327298-217327320 TCTGATTTACAGATGAAGGAAGG + Intergenic
921896462 1:220406637-220406659 TCCTAGTTACTGATGGGGCAGGG - Intergenic
922623546 1:227012887-227012909 TCTGAGATAAAGATGGTTCCGGG + Intronic
923889521 1:238196971-238196993 TCAGAGTCTCAGATGGAGCATGG + Intergenic
924147766 1:241094754-241094776 TCTGGATTGCAGATGTTGCAGGG + Intronic
924676564 1:246184472-246184494 TCTGAGGTACAGATTGAGGATGG - Intronic
1064293504 10:14056551-14056573 TTTCAGTTACAGAGGGTGGAGGG - Intronic
1065711427 10:28521956-28521978 TCTGAGTTATAGATGGTGCAGGG + Intergenic
1067043176 10:42969338-42969360 TCTGAGATTCAGATGGGGCTGGG - Intergenic
1067653326 10:48172938-48172960 TCTCAGTGACAGATGGTGAGAGG - Exonic
1068102105 10:52568513-52568535 TCTGAGATACAGATCTAGCAAGG + Intergenic
1070608134 10:77914043-77914065 GCTCATTTTCAGATGGTGCAGGG - Intronic
1074665938 10:115724232-115724254 TCTTAGTCACAAATGGTGGAAGG + Intronic
1079202464 11:18387312-18387334 TCTGAGAGACAGATGGGGCTTGG + Intergenic
1079347450 11:19665364-19665386 GCTGAGAAGCAGATGGTGCATGG + Intronic
1079887508 11:26005466-26005488 TCAGAGTTATAGCTGTTGCATGG - Intergenic
1080942703 11:36937795-36937817 TGTAAGTTTCAGATGGAGCATGG - Intergenic
1080992180 11:37550269-37550291 TCTCAGTTACAGATATTGTATGG + Intergenic
1083245564 11:61424852-61424874 CCTGAATTACAGATACTGCATGG - Intronic
1087216684 11:95502533-95502555 TTTGAGTTACAGAAGGTGCCAGG + Intergenic
1088888848 11:114029314-114029336 TCTCAGCTCCAGATGGTGGAAGG - Intergenic
1091650103 12:2303305-2303327 TCTGAGATCAAGGTGGTGCAGGG + Intronic
1094471690 12:30807413-30807435 GCTGAGTTACAGAGGTTCCAGGG - Intergenic
1095145263 12:38719966-38719988 TCTGATTTACAAATGGGGCCTGG - Intronic
1095297454 12:40543120-40543142 TCTGAGATAGAAATGGTGCATGG + Intronic
1095779967 12:46048655-46048677 CCTGAGATAGAGATGGAGCAGGG + Intergenic
1097186480 12:57199081-57199103 CCCCAGTTACAGATGGTTCATGG - Intronic
1098850868 12:75594380-75594402 TCTGAGTTATACATGGGGAACGG - Intergenic
1098924729 12:76336988-76337010 TCTGACTTAGAGATGGAGCATGG - Intergenic
1099009304 12:77272723-77272745 TCTGGGTTTCAGAAGGAGCAAGG + Intergenic
1104809798 12:131613218-131613240 CCTGGGTTACAGAGGGTCCAGGG - Intergenic
1106169668 13:27278140-27278162 TCTGAGTTAAAGAAGGGGAAAGG - Intergenic
1106842324 13:33697296-33697318 TTTGAGTGACAGATGGTATATGG - Intergenic
1107313798 13:39109141-39109163 ATTGAATTACAGAAGGTGCAGGG + Intergenic
1109618177 13:64864429-64864451 TCTGGTTTTCAGATGGTGCCTGG + Intergenic
1109951183 13:69503435-69503457 TCTGAGTTACAGTGGGTCCAGGG - Intergenic
1112231293 13:97591378-97591400 TCTGACTTACAGTGGGTCCACGG - Intergenic
1112470181 13:99681349-99681371 TATAACTTACAGATGGTTCACGG + Intronic
1113210942 13:107980051-107980073 TCTGTTCAACAGATGGTGCAGGG - Intergenic
1118852031 14:69591542-69591564 ACACAGTTACAGATGGTGCTGGG + Intergenic
1119312616 14:73662052-73662074 TCACAGTAACAGATGGTTCATGG + Intronic
1119664237 14:76473173-76473195 TCTGAGCTTCAGATCTTGCATGG + Intronic
1120047643 14:79826511-79826533 ACTGAGTTTCAAATGGTTCAGGG - Intronic
1120419000 14:84258752-84258774 TCAGAGTTTCAGAGGGAGCATGG - Intergenic
1120471686 14:84933623-84933645 TCGGGGGTACAGATGGTGCTTGG + Intergenic
1121419519 14:93802835-93802857 TCTGAGGTTCTGCTGGTGCATGG - Intergenic
1122056288 14:99100557-99100579 ACTCAGGTACAGGTGGTGCATGG - Intergenic
1122315714 14:100825125-100825147 TCTGAGTGGCAGAGCGTGCAGGG - Intergenic
1122470488 14:101962784-101962806 TCTGAGTCTCAGATGGTGGATGG + Intergenic
1126765148 15:52004149-52004171 TCTGAGTCACAGAGGGAGGAGGG + Intronic
1129524065 15:76203055-76203077 GCTGACCTACAGAGGGTGCAGGG - Intronic
1130806110 15:87324941-87324963 ACTGAGCTCCAGATGGTTCATGG - Intergenic
1132103250 15:99043159-99043181 CCAGAGTTACAGAGGGAGCATGG + Intergenic
1133901181 16:9976564-9976586 TCTGAGTCTCAGTTGGTTCAGGG - Intronic
1139526276 16:67518677-67518699 ACTGAGTTCCAGAGGGAGCAAGG - Intronic
1140602042 16:76488235-76488257 TCTGAGTTGCAGATCTGGCATGG - Intronic
1141678308 16:85529318-85529340 TCTGGGTTGCAGCTGGTGGAAGG + Intergenic
1142521499 17:507934-507956 TCTGAGTAACCCCTGGTGCAAGG - Intergenic
1143259714 17:5588951-5588973 TGTGAGTTACAGATTGGGAACGG + Intronic
1147019695 17:37521459-37521481 TCTGAGCTAAAGATGGGGTATGG + Intronic
1147466446 17:40614769-40614791 TTTGTGCTACACATGGTGCAAGG - Intergenic
1150498196 17:65625413-65625435 TCTGGGTTACAGTTGATGCTGGG - Intronic
1152434122 17:80264744-80264766 CCTGAGTTACAGCGGGGGCAGGG - Intronic
1155707241 18:28831373-28831395 TCTGGGTCAAAGATGGTGAAAGG - Intergenic
1164823255 19:31266049-31266071 TGTGAGTTACAGGTTCTGCAGGG + Intergenic
925931535 2:8712085-8712107 TCTGTGTTAGACATGCTGCACGG + Intergenic
926123581 2:10257741-10257763 TCTGAGTTTCAGGAGGAGCAGGG - Intergenic
927319365 2:21724530-21724552 TCTGAGATCCAGATGGTTCAAGG + Intergenic
927731265 2:25474101-25474123 TCTGAGTTAGAACTGGTGAAAGG + Intronic
932224054 2:70024986-70025008 TTTGAGCTACAGACAGTGCAAGG - Intergenic
932275027 2:70445191-70445213 TCTGAGTTAGAGAGGAAGCAAGG + Intergenic
933354537 2:81196128-81196150 TCTGAGGTAGAGATGGTGGCGGG + Intergenic
934842228 2:97633946-97633968 TCAGAGTTAAAGATGGTGGGGGG - Intergenic
935195592 2:100813307-100813329 AGTGAGTTCCAGATGGTTCAGGG - Intergenic
936389985 2:112063174-112063196 TCTGAGTGACTGATAGAGCATGG + Intronic
938329795 2:130441536-130441558 TCTGAGATGCAGGTGGTGCCAGG + Intergenic
938360151 2:130679967-130679989 TCTGAGATGCAGGTGGTGCCAGG - Intergenic
938436554 2:131286674-131286696 TCTGAGATGCAGGTGGTGCCAGG - Intronic
942809566 2:179981888-179981910 TCTGAGTTACTGATGTTTCTGGG + Exonic
947931867 2:233971502-233971524 TCTGAGGTGCAGATGGGGAATGG + Intronic
948229103 2:236336714-236336736 TTGGTGTTACAGATGGTGGAGGG - Intronic
1169513248 20:6288476-6288498 TCTGTGTGACAAATGGTGCTGGG + Intergenic
1174302750 20:49594139-49594161 TCTGTTTTACAGATGATGGAAGG - Intergenic
1175667476 20:60872629-60872651 TGTGAGTGACAGATTGTCCAGGG + Intergenic
1176699814 21:10032187-10032209 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
1177610817 21:23445570-23445592 TCTGAGGTACAGAATGTCCATGG - Intergenic
1180613388 22:17111908-17111930 TCTGTGTCCCAGATGGTGTATGG + Exonic
1181985548 22:26797888-26797910 ACTGAGCTTCAGATGGAGCAGGG + Intergenic
1183726459 22:39592668-39592690 TCTGGGTGACAGAGGGGGCAGGG - Intronic
1184558726 22:45248693-45248715 TCTCATTGACAGATGGAGCAGGG - Intergenic
949177594 3:1084645-1084667 TGTGAGTTAAAAATGGAGCAAGG - Intergenic
949785940 3:7742026-7742048 TCTGAGTTCCTGATGGGCCAAGG - Intergenic
955011120 3:55015336-55015358 TCTGTTTTGCAGATGGTGAATGG - Intronic
957966738 3:87331702-87331724 TCTAAATTACAGATGGTCCCTGG + Intergenic
960577774 3:119244323-119244345 TCTGAGTTCTAGATTGTGAAAGG + Intergenic
961518212 3:127451556-127451578 TCTGAGTTAAGGGTGGGGCAGGG + Intergenic
961545680 3:127631211-127631233 GCTGTGTGACAGATGCTGCAGGG + Intronic
962430733 3:135317136-135317158 TCTTAGTAGTAGATGGTGCAAGG + Intergenic
962991569 3:140582187-140582209 TCTGGGAGACAGATGGTGCAGGG + Intergenic
966197520 3:177328166-177328188 TCTTTGTTATAGTTGGTGCAAGG + Intergenic
967667006 3:192184497-192184519 TCTGAATTAGAGATGGTGAATGG + Intronic
969284620 4:6195102-6195124 CCTGAGTTGCAGAGGGTTCAGGG + Intronic
969523239 4:7691136-7691158 TCTGTGTGGCAGATGGTGCTGGG - Intronic
970445896 4:16123119-16123141 TCTGAGATCAAGATGTTGCAGGG - Intergenic
972067304 4:34964892-34964914 TCTGAGTCACAGATGCAGCTGGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
978343956 4:107746361-107746383 TCTGAGTTAAAGATGTTGGTAGG + Intergenic
980372226 4:131890797-131890819 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
980695217 4:136345792-136345814 TCTGATCTACAGATACTGCAAGG + Intergenic
983297085 4:165879786-165879808 TCTGAGCTCAAGATGCTGCAGGG - Intronic
986104843 5:4649937-4649959 TCTGCATGGCAGATGGTGCAGGG - Intergenic
987657282 5:20822861-20822883 TCTGACTTACAGAGGGTCCCTGG - Intergenic
988766264 5:34381087-34381109 TCTGACTTACAGAGGGTCCCTGG + Intergenic
989474382 5:41857423-41857445 TCTGAGGTCCAGATGTTGGAGGG - Intronic
990788046 5:59444913-59444935 TCTGAGTTACAGAACTTGAATGG - Intronic
991617578 5:68513198-68513220 ACTGAGGTCCAGATGGTGTATGG - Intergenic
994275331 5:97829934-97829956 TCTTAGTTACATGAGGTGCAAGG + Intergenic
995166977 5:109055073-109055095 TCTGCCTGACAGATGGTGCTGGG + Intronic
995792690 5:115908408-115908430 TCTAAGGTACTGATGGTGGAAGG + Intronic
1000023216 5:157336900-157336922 TCTGGGTTACATACTGTGCAGGG + Intronic
1002040515 5:176510598-176510620 TCTGATTTACAGATTCTGGATGG + Intergenic
1002206890 5:177569146-177569168 CCTGAGTTGCAGACAGTGCAGGG - Intergenic
1003986037 6:11436207-11436229 TCTGAGATCCACATGGTCCAAGG + Intergenic
1004168961 6:13280973-13280995 TCAGAGTCACAGTTGGTGCACGG - Intronic
1007570708 6:42888601-42888623 TCTGAGTTACAGATGGTGCAGGG - Exonic
1011706747 6:90008248-90008270 TCTGTCTTTCAGATGGTGTAAGG - Intronic
1013106762 6:107032395-107032417 TCTGAGCTCCAGCTGATGCAGGG - Intronic
1013106831 6:107032892-107032914 TCTGCGCTCCAGCTGGTGCAGGG + Intronic
1017861343 6:158400807-158400829 TGTGTGTTATAGATGGTGCCTGG + Intronic
1019706383 7:2499060-2499082 TCTGTGCTTCAGATGGGGCAGGG - Intergenic
1020152098 7:5690505-5690527 TCTAAGTGGTAGATGGTGCAGGG - Intronic
1020275403 7:6621410-6621432 TTTCAGTTCCTGATGGTGCACGG - Exonic
1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG + Intronic
1022175843 7:27870781-27870803 CCTGAGTCACAGATGCTGCTCGG + Intronic
1022794174 7:33718977-33718999 TCAGAGTTACAGAGGATGCAAGG - Intergenic
1030190833 7:106808626-106808648 TCTGAGTGACAGTTGGTTGAAGG + Intergenic
1035131129 7:156654677-156654699 TCTTCTTTACAGATGGGGCATGG - Exonic
1041203170 8:55471437-55471459 TCCGAGTTTCAGATTCTGCATGG - Intronic
1042944750 8:74144052-74144074 TCAGGGGTACAGATTGTGCAAGG + Intergenic
1044492882 8:92841412-92841434 TATGAGAGAGAGATGGTGCAAGG - Intergenic
1048578449 8:135711080-135711102 TCTGAGTTCCAGCTGGAGGAAGG - Intergenic
1049593285 8:143472198-143472220 TCTGGGTTGCTGCTGGTGCAGGG + Intronic
1050586483 9:7117351-7117373 TCTCAATTACAGTTGGTGAATGG - Intergenic
1053636963 9:40018656-40018678 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
1053769066 9:41446246-41446268 TGTGAGGTACAGGTGGAGCAAGG - Intergenic
1054317792 9:63615449-63615471 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
1054547737 9:66357747-66357769 TGTGAGGTACAGGTGGAGCAAGG - Intergenic
1056132370 9:83599217-83599239 TGTGAGTTACAGATTGGGAATGG - Intergenic
1056734708 9:89199232-89199254 TCTGATTTAAAAATGGTGAAAGG + Intergenic
1057442700 9:95093438-95093460 TTAAAGTTACAGATGGTGCCTGG + Intergenic
1058547393 9:106075386-106075408 TCTATGTTACAGATGGGGCTTGG + Intergenic
1062190310 9:135244594-135244616 TCTGAGTCACAGGTGGTACCTGG + Intergenic
1202784827 9_KI270719v1_random:2246-2268 TGTGAGGTACAGGTGGAGCAAGG + Intergenic
1187868459 X:23744522-23744544 CATGAGTTACACATGGAGCATGG + Intronic
1189429868 X:40936882-40936904 TCCCAGTTATAGATGGTGCAGGG + Intergenic
1190108648 X:47575384-47575406 TCTGAGGCACTGATTGTGCACGG + Intronic
1190503644 X:51103749-51103771 TGTGAGGTACTGATGATGCAAGG + Intergenic
1193783851 X:85735149-85735171 TCAGTTTTACAGTTGGTGCAGGG + Intergenic
1197768175 X:130072364-130072386 GCAGAGTGACAGCTGGTGCAGGG + Exonic
1199373209 X:147075655-147075677 TCTGAGTTACAGCTGTGGCCAGG + Intergenic
1199773625 X:150991714-150991736 TCTTAGTTTCAGATTGTTCATGG - Intergenic
1200115110 X:153766494-153766516 TGTGAGTCACAGAGGGGGCAGGG - Intronic