ID: 1007581158

View in Genome Browser
Species Human (GRCh38)
Location 6:42960929-42960951
Sequence GCACCCGCTGGCAGCCGTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007581158_1007581171 23 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581171 6:42960975-42960997 TGAGCCCAGGCCGGGGCCGGGGG 0: 1
1: 0
2: 4
3: 100
4: 906
1007581158_1007581162 0 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581162 6:42960952-42960974 TCGACGTAGCCTGTGGCACTGGG 0: 1
1: 0
2: 1
3: 3
4: 42
1007581158_1007581170 22 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581170 6:42960974-42960996 GTGAGCCCAGGCCGGGGCCGGGG 0: 1
1: 0
2: 1
3: 49
4: 538
1007581158_1007581166 15 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581166 6:42960967-42960989 GCACTGGGTGAGCCCAGGCCGGG 0: 1
1: 0
2: 4
3: 51
4: 535
1007581158_1007581160 -7 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581160 6:42960945-42960967 CGGGTGCTCGACGTAGCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 25
1007581158_1007581164 10 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581164 6:42960962-42960984 CTGTGGCACTGGGTGAGCCCAGG 0: 1
1: 0
2: 3
3: 33
4: 340
1007581158_1007581161 -1 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581161 6:42960951-42960973 CTCGACGTAGCCTGTGGCACTGG 0: 1
1: 0
2: 1
3: 3
4: 50
1007581158_1007581168 20 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581168 6:42960972-42960994 GGGTGAGCCCAGGCCGGGGCCGG 0: 1
1: 0
2: 6
3: 95
4: 707
1007581158_1007581169 21 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581169 6:42960973-42960995 GGTGAGCCCAGGCCGGGGCCGGG 0: 1
1: 0
2: 4
3: 80
4: 703
1007581158_1007581167 16 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581167 6:42960968-42960990 CACTGGGTGAGCCCAGGCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 269
1007581158_1007581165 14 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581165 6:42960966-42960988 GGCACTGGGTGAGCCCAGGCCGG 0: 1
1: 0
2: 9
3: 72
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007581158 Original CRISPR GCACCCGCTGGCAGCCGTGC TGG (reversed) Exonic
900460538 1:2800488-2800510 GCACCTGCTGGCAGGTCTGCTGG - Intronic
901320614 1:8337993-8338015 GTACCCGCTGCCAGCCAGGCTGG + Intronic
902747096 1:18481504-18481526 GCAGCCGACGGCAGCTGTGCCGG + Exonic
902843254 1:19088872-19088894 GAACCTGCTGGAAGCCCTGCGGG - Exonic
906527899 1:46507079-46507101 GCACCAGCAGGCAGCCCAGCAGG + Exonic
907594116 1:55703948-55703970 GCACCAGCTGGGAGCCCTCCTGG - Intergenic
908354439 1:63317099-63317121 GCTCCCTCTGGCGGCCGGGCTGG - Intergenic
912246405 1:107965339-107965361 GCCCCCGCCTGCAGCCTTGCGGG + Intergenic
916179162 1:162069597-162069619 GCCCGCGCTGCCAGCCGAGCAGG - Intergenic
920204955 1:204284501-204284523 CCACCAGCAGGCAGCAGTGCAGG - Intronic
1067497869 10:46775255-46775277 GAAGCTGCTGGCCGCCGTGCAGG - Intergenic
1067596781 10:47565159-47565181 GAAGCTGCTGGCCGCCGTGCAGG + Intergenic
1069660985 10:70123371-70123393 GAGCCAGCTGGCAGCCGGGCTGG + Intronic
1074585848 10:114767765-114767787 GCTCGCGCTGGCTGCCCTGCCGG - Intergenic
1075144585 10:119872536-119872558 CCACCCGCTGGGAATCGTGCAGG - Exonic
1076401975 10:130190621-130190643 GCAGCCGCAGGCAGCGGGGCGGG - Intergenic
1077195687 11:1278885-1278907 GCCCCGGCTGGCAGGCGGGCAGG + Intronic
1077354757 11:2109960-2109982 GCAGGAGCTGGCAGCCATGCTGG + Intergenic
1081770827 11:45649786-45649808 GCACCTGCTGGCAGGCGTTCTGG + Exonic
1081866578 11:46363631-46363653 GCACCCGTGGGCAGCGGTGAGGG - Intronic
1084175591 11:67420755-67420777 GGCCGCGCTGGCCGCCGTGCTGG + Exonic
1084688671 11:70712116-70712138 GCAGCCTCTGGAAGCCGGGCGGG - Intronic
1085689664 11:78654906-78654928 GGACCAGTTGGCAGCTGTGCGGG + Exonic
1089493798 11:118898756-118898778 GCCCCCGCTGGACGCCCTGCTGG + Exonic
1091087902 11:132741027-132741049 GCACCCTCTGTCACCCATGCTGG - Intronic
1091203492 11:133800853-133800875 GCAGCGGCTGGCAGCCTTGCTGG - Intergenic
1095722076 12:45411817-45411839 GCACCTGCTGCCTGCCGTGGTGG + Intronic
1096115730 12:49054042-49054064 GGAACCGCTGGCAGTCGCGCAGG + Exonic
1096979783 12:55721753-55721775 GCACCCGCTGGAAATCGTCCCGG - Exonic
1105240954 13:18609446-18609468 GCAGCCGCGGGCAGCCAAGCAGG - Intergenic
1105474972 13:20721344-20721366 GCACCTGTGGGCACCCGTGCAGG + Intronic
1106568399 13:30906288-30906310 CCACTCGCTGGGAGCCCTGCAGG - Exonic
1113899980 13:113791348-113791370 GCACCTGCCGGCCGCCGAGCCGG + Intronic
1122061507 14:99139419-99139441 GCACCAGCTGGAGGCCCTGCTGG - Intergenic
1122075282 14:99231524-99231546 GCCACCGCTGGCAGCTGGGCAGG + Exonic
1122309397 14:100785021-100785043 ACACCCACTGGCAGATGTGCTGG - Intergenic
1122357784 14:101134329-101134351 GCACCCGCTGCCAGCTGTCTGGG - Intergenic
1122984519 14:105206061-105206083 TCATCCGCTGTCAGCTGTGCTGG + Intergenic
1125768556 15:42150607-42150629 GGAGCTGCTGGCAGCTGTGCAGG - Exonic
1129742014 15:77993852-77993874 GCACCTGCAGGCAGCCGCCCTGG - Intronic
1129798391 15:78395352-78395374 GCACCCGCTGACAGCTGAGATGG + Intergenic
1132589725 16:721400-721422 GCACGCGCCGGAAGCCGGGCTGG - Exonic
1133038920 16:3049631-3049653 GAACCCCCTGGGAGCTGTGCAGG - Intronic
1133136715 16:3717424-3717446 GCCGGCGCTGGCGGCCGTGCCGG - Exonic
1135149696 16:19994868-19994890 GCAGCCCCTGGCAGTCCTGCTGG + Intergenic
1138196536 16:55056658-55056680 GCTCTCGCTGCCAGCCCTGCCGG + Intergenic
1138360861 16:56425776-56425798 GCAGGCGCTGGCAGGCGGGCAGG + Intergenic
1140323511 16:73977455-73977477 GCAGCTGGTGGCAGCCATGCTGG - Intergenic
1141138385 16:81481552-81481574 GCACCCTCTGGGAGCCGCTCTGG - Intronic
1141682602 16:85553301-85553323 GCACCCGCCGGCAGCGGCGGCGG - Intergenic
1142263347 16:89052534-89052556 GCGATCGCTGGCAGCCGTGGCGG - Intergenic
1142683436 17:1563001-1563023 GCACCCGCGTGCATCCGTGGCGG - Intergenic
1143870868 17:9956612-9956634 GCAGGGGCTGGCAGCCTTGCTGG - Intronic
1147686281 17:42288565-42288587 GCACCGTCCGGCAGCCGGGCCGG - Exonic
1147720467 17:42536605-42536627 GCGGCCACTGCCAGCCGTGCCGG + Exonic
1148194511 17:45703630-45703652 GCACCTGCTGGGAGCAGAGCAGG - Intergenic
1148559153 17:48596234-48596256 GCACCCGCCGGGAGCTGTGCGGG + Exonic
1149637229 17:58180762-58180784 GCACCCTGTGGCAGGCGTGGAGG + Intergenic
1151767569 17:76140200-76140222 GCACCTGGTGGTAGCCGTGGGGG + Exonic
1152165984 17:78706525-78706547 TCACCTGCTGGCAGCCATTCAGG + Intronic
1153688613 18:7568646-7568668 GGACCCCCGGGCAGCCGGGCTGG - Intronic
1160172073 18:76563282-76563304 GCAGCCACTGGGAGCCGAGCCGG - Intergenic
1160502921 18:79411133-79411155 TGACCCGCGGGGAGCCGTGCGGG - Exonic
1160841333 19:1148134-1148156 GGACCTGCTGCCAGCCCTGCTGG - Intronic
1161447691 19:4327591-4327613 GTCCCCGCTGGGAGCAGTGCTGG - Intronic
1161793795 19:6375332-6375354 GCAGCCGCTGCCAGCGGTGGCGG + Exonic
1162032642 19:7924087-7924109 GCACCCTCTGCCAGCCCTGGAGG - Intergenic
1162195242 19:8979633-8979655 GCTCCCGTGGGCAGCTGTGCTGG + Exonic
1162836021 19:13318520-13318542 GCACCCTCTGGCTGCCGAGTGGG + Intronic
1162957421 19:14107102-14107124 GAAGCTGCTGGCAGCTGTGCTGG + Intronic
1163462634 19:17448240-17448262 GCTGCCGCTGGCCGCCGCGCTGG - Exonic
1166000899 19:39876912-39876934 TGACGGGCTGGCAGCCGTGCTGG + Exonic
1166003680 19:39893165-39893187 TGACGGGCTGGCAGCCGTGCTGG + Exonic
1168714511 19:58519101-58519123 GCTCCCTCTGGCTGCCGTGTGGG - Intronic
927678475 2:25124140-25124162 TGACCCGGTGGCAGCTGTGCTGG + Intronic
928299068 2:30109785-30109807 CCACACGCTGGGAGCAGTGCTGG - Intergenic
928528478 2:32165862-32165884 GCTCCCGCCGGAAGCCGTTCTGG - Exonic
931695177 2:64865732-64865754 GCGCCCCCTGGCGGCCGCGCGGG + Intergenic
935333118 2:101991819-101991841 GCACCCCCAGGCTGCAGTGCTGG - Intergenic
942044349 2:172090728-172090750 GCTCCCGCGGGCAGCAGCGCTGG - Intergenic
948852982 2:240717476-240717498 GCACAGGCAGGCAGCCGTGAGGG + Intronic
949050408 2:241894804-241894826 GCACCCACAGGCAGCCGGGCAGG - Intronic
1169092950 20:2872635-2872657 GCACCCGCGGGGATCCGTGTAGG + Intronic
1170840653 20:19922402-19922424 GCCCCCTCTGGCAGAAGTGCTGG + Intronic
1172460620 20:35115696-35115718 TCAGCCTCTGGCAGCAGTGCAGG + Exonic
1172871375 20:38137540-38137562 GCAGCTGGTGGCAGCCATGCTGG + Intronic
1175580317 20:60093857-60093879 GCACATGCTGGCATCCTTGCAGG + Intergenic
1176302690 21:5106063-5106085 GCACTCGCTCGGAGCCGCGCAGG + Intergenic
1176448218 21:6840247-6840269 GCAGCCGCGGGCAGCCGAGCAGG - Intergenic
1176826388 21:13705269-13705291 GCAGCCGCGGGCAGCCGAGCAGG - Intergenic
1179854335 21:44155860-44155882 GCACTCGCTCGGAGCCGCGCAGG - Intergenic
1180228352 21:46411794-46411816 GCAGCCCCTGGCAGCCGGGGCGG + Exonic
1181013904 22:20057435-20057457 GCACCAGCTGGTAGGCGTGGGGG - Intronic
1183394158 22:37561788-37561810 TCACCCGCAGGCCGCAGTGCTGG - Intronic
1183685745 22:39360502-39360524 GCAGCGTCTGGCAGCCGTGAGGG + Intronic
1184214636 22:43058641-43058663 GCAGCCTCTGGCAGATGTGCAGG + Intronic
1185268736 22:49918673-49918695 CCACCCGCTCCCAGCCGCGCCGG - Exonic
949260690 3:2099568-2099590 GCGCCCGCTGGGTGCCGGGCTGG + Intronic
949587415 3:5455349-5455371 GTAGCCGCTGGCAGCCGTCTTGG + Intergenic
950201971 3:11050843-11050865 GCTCCCACTCGCAGCCATGCAGG + Intergenic
954115792 3:48466235-48466257 GCTCTCGCTGGCAGCAGTGGCGG - Exonic
954205696 3:49057392-49057414 GCAGCCGGTGGCCACCGTGCTGG - Exonic
960110281 3:113838745-113838767 GCGCCCTCTGGCGGCCGTGAAGG - Exonic
961692604 3:128680860-128680882 GCGCCCTCTGGCGGCAGTGCCGG - Intronic
965845039 3:172951674-172951696 GCACAAGCTGGCAGAGGTGCTGG - Intronic
967164951 3:186772474-186772496 GCACCCGCCGCCAGCCCAGCTGG - Intergenic
968189853 3:196659904-196659926 GCTCCAGGTGGCAGCTGTGCAGG - Exonic
968582246 4:1400542-1400564 GCACCCACTGGCACCAGAGCTGG + Intergenic
968757382 4:2423849-2423871 GCACCTCCAGGCAGCCTTGCTGG + Intronic
969715897 4:8867941-8867963 GCGGCAGCTGGCAGCCGAGCTGG - Exonic
982219425 4:153112130-153112152 GCACCCGCATGCAGGTGTGCCGG + Intergenic
982343709 4:154333006-154333028 GCATCCTCAGGCAGCCCTGCTGG - Exonic
985720108 5:1484519-1484541 GCACTCGCTGGCAGCCTGGGAGG - Intronic
986190849 5:5494900-5494922 GCACCTGCCGGCAGGCCTGCGGG - Intergenic
1002001517 5:176199022-176199044 GCGCCCGCGGGCAGCGGGGCTGG - Intergenic
1002802595 6:539394-539416 GCACTGGCTGGCATCAGTGCCGG - Intronic
1004229019 6:13814369-13814391 GAAGCCGCTGGCGGCCGGGCAGG + Exonic
1006665109 6:35688343-35688365 GCTCCCGCCCGCAGCGGTGCCGG + Intronic
1007581158 6:42960929-42960951 GCACCCGCTGGCAGCCGTGCTGG - Exonic
1019129749 6:169864919-169864941 GCACCTGCTGGCAGCAGAGCCGG + Intergenic
1019501495 7:1367039-1367061 GCACCCGCAGGCAGCTGAGGAGG - Intergenic
1022055322 7:26726189-26726211 TCAGCAGCTGGCAGCTGTGCAGG + Intronic
1024550993 7:50562275-50562297 GCTCCCTCCAGCAGCCGTGCAGG + Intronic
1030128509 7:106177751-106177773 GCATCCGCTAACAGCAGTGCCGG + Intergenic
1035206120 7:157295052-157295074 TCAGTGGCTGGCAGCCGTGCAGG - Intergenic
1047694297 8:127387710-127387732 GCACCAGCTGGTAGCAGTGGAGG - Intergenic
1049818679 8:144621051-144621073 GCCCCAGTTGGCAGCTGTGCTGG + Intergenic
1061665989 9:132161454-132161476 GGACCCGCTGGCCCCCGGGCCGG + Intergenic
1061680907 9:132242060-132242082 GCAGCAGCAGGCAGCCGAGCAGG - Exonic
1062008172 9:134252184-134252206 GCACCTGCTGTCAGCTGTGCAGG + Intergenic
1062024500 9:134334033-134334055 GCTCCCGCTGGCAAGCCTGCTGG + Intronic
1062164590 9:135101173-135101195 GCACCCGCTGCCGGCCGTCCTGG + Intronic
1062293008 9:135805820-135805842 GCACCCGCAGGCAGCACAGCAGG - Intergenic
1062476971 9:136733067-136733089 GCACTCGCCAGCAGCCCTGCAGG - Intergenic
1062656970 9:137608761-137608783 GAAGCAGCTGGCAGCTGTGCGGG + Intronic
1203520973 Un_GL000213v1:44271-44293 GCAGCCGCGGGCAGCCGAGCAGG + Intergenic
1187443845 X:19343851-19343873 GCACCCCCTGGACGCCGTTCTGG + Intergenic
1189659317 X:43279685-43279707 GCAGCGGCTGGCGGCCGCGCGGG - Intergenic
1190117927 X:47637968-47637990 ACAACCGCGGGCAGCCGGGCTGG + Exonic
1201458303 Y:14194803-14194825 GAACCAGCTGGCAGCCTAGCAGG - Intergenic