ID: 1007581159

View in Genome Browser
Species Human (GRCh38)
Location 6:42960941-42960963
Sequence AGGCTACGTCGAGCACCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 23}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007581159_1007581165 2 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581165 6:42960966-42960988 GGCACTGGGTGAGCCCAGGCCGG 0: 1
1: 0
2: 9
3: 72
4: 508
1007581159_1007581176 27 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG 0: 1
1: 0
2: 0
3: 5
4: 32
1007581159_1007581164 -2 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581164 6:42960962-42960984 CTGTGGCACTGGGTGAGCCCAGG 0: 1
1: 0
2: 3
3: 33
4: 340
1007581159_1007581177 28 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581177 6:42960992-42961014 CGGGGGCGTTGCATGAGATCGGG 0: 1
1: 0
2: 0
3: 10
4: 237
1007581159_1007581170 10 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581170 6:42960974-42960996 GTGAGCCCAGGCCGGGGCCGGGG 0: 1
1: 0
2: 1
3: 49
4: 538
1007581159_1007581166 3 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581166 6:42960967-42960989 GCACTGGGTGAGCCCAGGCCGGG 0: 1
1: 0
2: 4
3: 51
4: 535
1007581159_1007581169 9 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581169 6:42960973-42960995 GGTGAGCCCAGGCCGGGGCCGGG 0: 1
1: 0
2: 4
3: 80
4: 703
1007581159_1007581167 4 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581167 6:42960968-42960990 CACTGGGTGAGCCCAGGCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 269
1007581159_1007581168 8 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581168 6:42960972-42960994 GGGTGAGCCCAGGCCGGGGCCGG 0: 1
1: 0
2: 6
3: 95
4: 707
1007581159_1007581178 29 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581178 6:42960993-42961015 GGGGGCGTTGCATGAGATCGGGG 0: 1
1: 0
2: 0
3: 7
4: 64
1007581159_1007581171 11 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581171 6:42960975-42960997 TGAGCCCAGGCCGGGGCCGGGGG 0: 1
1: 0
2: 4
3: 100
4: 906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007581159 Original CRISPR AGGCTACGTCGAGCACCCGC TGG (reversed) Exonic
1065025274 10:21534740-21534762 AGGCTGGGCCGAGAACCCGCTGG + Exonic
1078921758 11:15837252-15837274 AGGCTACGTGGAGTACCAGGTGG + Intergenic
1091237360 11:134031191-134031213 TGGCTACCTCGAGCCCACGCTGG + Intergenic
1115474588 14:33800701-33800723 GGGCAACGTCGTGCTCCCGCTGG + Exonic
1132865420 16:2090694-2090716 AGGCTACCCCGAGCACCACCAGG + Exonic
1163786715 19:19278602-19278624 AGGCTACTTTGGGCACCTGCAGG + Intronic
1165377013 19:35449917-35449939 AGGCTGCGTCGAACTTCCGCTGG + Exonic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
947729642 2:232420828-232420850 AGGCTCCGGCGCGCACCTGCCGG - Intergenic
1173785788 20:45792016-45792038 TGGCGACGCCGAGCAGCCGCGGG + Exonic
1176553207 21:8239022-8239044 AGGATACATCCAGCACCCGGGGG - Intergenic
1176572129 21:8422046-8422068 AGGATACATCCAGCACCCGGGGG - Intergenic
1176580038 21:8466629-8466651 AGGATACATCCAGCACCCGGGGG - Intergenic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1184785160 22:46668134-46668156 GGGCGACGTCCAGCACCAGCTGG - Exonic
1203258205 22_KI270733v1_random:156064-156086 AGGATACATCCAGCACCCGGGGG - Intergenic
975698371 4:77037384-77037406 AGGCTATGTAGAGCACAGGCAGG - Exonic
1007581159 6:42960941-42960963 AGGCTACGTCGAGCACCCGCTGG - Exonic
1017183786 6:151579567-151579589 AGGCTCTGTAGAGCACCCTCAGG + Intronic
1017919168 6:158856467-158856489 AGGCAGCGCCGAGCACCGGCTGG + Intergenic
1019479678 7:1260672-1260694 AGGCCAGGCCGGGCACCCGCAGG - Intergenic
1034136226 7:148772825-148772847 AGGCTACGTCCAGACCCTGCAGG - Intronic
1203474399 Un_GL000220v1:138087-138109 AGGATACATCCAGCACCCGGGGG - Intergenic
1199556426 X:149114137-149114159 AGGCTGGGTCCAGCACCTGCTGG - Intergenic